Transcript: Human XM_024449418.1

PREDICTED: Homo sapiens tudor domain containing 3 (TDRD3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDRD3 (81550)
Length:
2980
CDS:
751..2706

Additional Resources:

NCBI RefSeq record:
XM_024449418.1
NBCI Gene record:
TDRD3 (81550)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356049 AGACGAATAGGACCTATTAAG pLKO_005 2263 CDS 100% 13.200 18.480 N TDRD3 n/a
2 TRCN0000073297 CGTACTTCTTACAAGCAATAA pLKO.1 1434 CDS 100% 13.200 18.480 N TDRD3 n/a
3 TRCN0000367423 ACGAAGATCTGGGCCAATTAA pLKO_005 2346 CDS 100% 15.000 12.000 N TDRD3 n/a
4 TRCN0000367466 AGTAGCTGTGGTGGATATTAT pLKO_005 2801 3UTR 100% 15.000 10.500 N TDRD3 n/a
5 TRCN0000073294 GCAGTGGATTACCTAGAAATA pLKO.1 1796 CDS 100% 13.200 9.240 N TDRD3 n/a
6 TRCN0000222581 CGGGTATGACAGCAGTTGTTA pLKO.1 2498 CDS 100% 5.625 3.938 N TDRD3 n/a
7 TRCN0000073293 CCTTCCACTTTCTCTTCAGAA pLKO.1 2778 3UTR 100% 4.950 3.465 N TDRD3 n/a
8 TRCN0000073295 GCAGAGAACTTGATCGAAGAA pLKO.1 1067 CDS 100% 4.950 3.465 N TDRD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04235 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04235 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479596 AACCGTCCCGTTAGTCGCAACCCA pLX_317 16.6% 100% 100% V5 n/a
Download CSV