Transcript: Human XM_024449429.1

PREDICTED: Homo sapiens StAR related lipid transfer domain containing 13 (STARD13), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STARD13 (90627)
Length:
6488
CDS:
813..4049

Additional Resources:

NCBI RefSeq record:
XM_024449429.1
NBCI Gene record:
STARD13 (90627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413632 GCTTATGATGTGGCGGATATG pLKO_005 2889 CDS 100% 10.800 15.120 N STARD13 n/a
2 TRCN0000417473 GAACTGAAGGACGCGGTTAAT pLKO_005 4142 3UTR 100% 13.200 10.560 N STARD13 n/a
3 TRCN0000047845 CCAAGGCACTTTCTATTGAAA pLKO.1 1927 CDS 100% 5.625 4.500 N STARD13 n/a
4 TRCN0000413358 TGGCTACATCCCTACTAATAT pLKO_005 4242 3UTR 100% 15.000 10.500 N STARD13 n/a
5 TRCN0000047843 CCTCCCTCTTTCATCTTAATT pLKO.1 3154 CDS 100% 15.000 9.000 N STARD13 n/a
6 TRCN0000047847 CAGCAGAAGTTGCCAGGATTA pLKO.1 3979 CDS 100% 10.800 6.480 N STARD13 n/a
7 TRCN0000047844 CCCAGTGATGTGGAAAGAGAT pLKO.1 2349 CDS 100% 4.950 2.970 N STARD13 n/a
8 TRCN0000047846 GCCAGAGTCCTTTAAGGCTAT pLKO.1 1589 CDS 100% 4.050 2.430 N STARD13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12943 pDONR223 100% 59% 58% None (many diffs) n/a
2 ccsbBroad304_12943 pLX_304 0% 59% 58% V5 (many diffs) n/a
3 TRCN0000491352 TCCCAGGAATAGTAAGTTAATGTA pLX_317 16.1% 59% 58% V5 (many diffs) n/a
Download CSV