Transcript: Human XM_024449901.1

PREDICTED: Homo sapiens solute carrier family 24 member 5 (SLC24A5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC24A5 (283652)
Length:
2406
CDS:
1555..2406

Additional Resources:

NCBI RefSeq record:
XM_024449901.1
NBCI Gene record:
SLC24A5 (283652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418034 GGCTACTCTCAGCTCTCTATA pLKO_005 2035 CDS 100% 13.200 18.480 N SLC24A5 n/a
2 TRCN0000044882 GCCTGTGGTTTGCTATCTAAT pLKO.1 1681 CDS 100% 13.200 9.240 N SLC24A5 n/a
3 TRCN0000044879 CCGATACAGTAATGGGCCTTA pLKO.1 2312 CDS 100% 4.050 2.835 N SLC24A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05364 pDONR223 100% 56.2% 56.4% None 0_1ins339;843_845delTAA;849_849delCins316 n/a
2 ccsbBroad304_05364 pLX_304 0% 56.2% 56.4% V5 0_1ins339;843_845delTAA;849_849delCins316 n/a
3 TRCN0000466170 TGGCAGACGGTATGTAAAAATCTA pLX_317 26% 56.2% 56.4% V5 0_1ins339;843_845delTAA;849_849delCins316 n/a
Download CSV