Transcript: Human XM_024449972.1

PREDICTED: Homo sapiens TIMELESS interacting protein (TIPIN), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TIPIN (54962)
Length:
1823
CDS:
151..1056

Additional Resources:

NCBI RefSeq record:
XM_024449972.1
NBCI Gene record:
TIPIN (54962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167576 GCGGAGAATAATGAACATGAT pLKO.1 634 CDS 100% 4.950 6.930 N TIPIN n/a
2 TRCN0000292480 GCGGAGAATAATGAACATGAT pLKO_005 634 CDS 100% 4.950 6.930 N TIPIN n/a
3 TRCN0000167815 GATCCCTTTCTGACAAACTTA pLKO.1 673 CDS 100% 5.625 3.938 N TIPIN n/a
4 TRCN0000292481 GATCCCTTTCTGACAAACTTA pLKO_005 673 CDS 100% 5.625 3.938 N TIPIN n/a
5 TRCN0000168356 GAGTTGAATACCTGGGAAGTA pLKO.1 527 CDS 100% 4.950 3.465 N TIPIN n/a
6 TRCN0000292478 GAGTTGAATACCTGGGAAGTA pLKO_005 527 CDS 100% 4.950 3.465 N TIPIN n/a
7 TRCN0000172610 GCTGAGTAATAGTCAGACCCT pLKO.1 804 CDS 100% 0.660 0.462 N TIPIN n/a
8 TRCN0000297994 GCTGAGTAATAGTCAGACCCT pLKO_005 804 CDS 100% 0.660 0.462 N TIPIN n/a
9 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 1627 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1700 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1700 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03499 pDONR223 100% 99.8% 99.6% None 158G>C n/a
2 ccsbBroad304_03499 pLX_304 0% 99.8% 99.6% V5 158G>C n/a
3 TRCN0000468470 CAATCCAGCACGATGTTGTAGGGA pLX_317 41.6% 99.8% 99.6% V5 158G>C n/a
Download CSV