Transcript: Human XM_024450096.1

PREDICTED: Homo sapiens capping actin protein of muscle Z-line subunit beta (CAPZB), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPZB (832)
Length:
1782
CDS:
473..1030

Additional Resources:

NCBI RefSeq record:
XM_024450096.1
NBCI Gene record:
CAPZB (832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029347 GACCAGTATCGAGACCTGTAT pLKO.1 524 CDS 100% 4.950 6.930 N CAPZB n/a
2 TRCN0000318894 GACCAGTATCGAGACCTGTAT pLKO_005 524 CDS 100% 4.950 6.930 N CAPZB n/a
3 TRCN0000029344 AGATGGATCAAAGAAGATCAA pLKO.1 625 CDS 100% 4.950 3.465 N CAPZB n/a
4 TRCN0000318967 AGATGGATCAAAGAAGATCAA pLKO_005 625 CDS 100% 4.950 3.465 N CAPZB n/a
5 TRCN0000029348 GAACGAGATCTACTTTGGAAA pLKO.1 895 CDS 100% 4.950 3.465 N CAPZB n/a
6 TRCN0000318899 GAACGAGATCTACTTTGGAAA pLKO_005 895 CDS 100% 4.950 3.465 N CAPZB n/a
7 TRCN0000029345 CCTATAGGTCACCATGGAGTA pLKO.1 420 5UTR 100% 4.050 2.835 N CAPZB n/a
8 TRCN0000029346 GCCTGGTAGAGGACATGGAAA pLKO.1 855 CDS 100% 4.950 2.970 N CAPZB n/a
9 TRCN0000318964 GCCTGGTAGAGGACATGGAAA pLKO_005 855 CDS 100% 4.950 2.970 N CAPZB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00218 pDONR223 100% 68% 68% None 0_1ins261 n/a
2 ccsbBroad304_00218 pLX_304 0% 68% 68% V5 0_1ins261 n/a
3 TRCN0000472378 GTTACTGCGCTTCTCCCTAGTCGT pLX_317 55.5% 68% 68% V5 0_1ins261 n/a
Download CSV