Transcript: Human XM_024450114.1

PREDICTED: Homo sapiens uncharacterized LOC112268145 (LOC112268145), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC112268145 (112268145)
Length:
1351
CDS:
1..1167

Additional Resources:

NCBI RefSeq record:
XM_024450114.1
NBCI Gene record:
LOC112268145 (112268145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143372 GCTGTTATGAGGAGAAGCAAA pLKO.1 650 CDS 100% 4.950 2.475 Y COMMD4 n/a
2 TRCN0000142568 GTTTGAGTCAGGCGATGTGAA pLKO.1 504 CDS 100% 4.950 2.475 Y COMMD4 n/a
3 TRCN0000140987 CAGTGCTGAGTTTCATCCTCT pLKO.1 536 CDS 100% 2.640 1.320 Y COMMD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450114.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03489 pDONR223 100% 41.6% 30.2% None (many diffs) n/a
2 ccsbBroad304_03489 pLX_304 0% 41.6% 30.2% V5 (many diffs) n/a
3 TRCN0000479852 TGGTAACCCCCCAGACACTCCAAT pLX_317 62% 41.6% 30.2% V5 (many diffs) n/a
Download CSV