Transcript: Human XM_024450200.1

PREDICTED: Homo sapiens golgi associated, gamma adaptin ear containing, ARF binding protein 2 (GGA2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GGA2 (23062)
Length:
5420
CDS:
422..2152

Additional Resources:

NCBI RefSeq record:
XM_024450200.1
NBCI Gene record:
GGA2 (23062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298454 GATGATGCACTCGCGGAAATT pLKO_005 1178 CDS 100% 13.200 18.480 N GGA2 n/a
2 TRCN0000379641 CACAAGATGGACCCTTCATTT pLKO_005 2158 3UTR 100% 13.200 9.240 N GGA2 n/a
3 TRCN0000293222 GCTGTTCTCAGGGACCTTAAA pLKO_005 2588 3UTR 100% 13.200 9.240 N GGA2 n/a
4 TRCN0000065003 GCTTCTGACAAGGCTTCTAAA pLKO.1 889 CDS 100% 13.200 9.240 N GGA2 n/a
5 TRCN0000286144 GCTTCTGACAAGGCTTCTAAA pLKO_005 889 CDS 100% 13.200 9.240 N GGA2 n/a
6 TRCN0000379404 TCCTGAACGAACTGATCAAAG pLKO_005 627 CDS 100% 10.800 7.560 N GGA2 n/a
7 TRCN0000065006 CCGTGCCCTCTGAATTATGTT pLKO.1 1592 CDS 100% 5.625 3.938 N GGA2 n/a
8 TRCN0000286090 CCGTGCCCTCTGAATTATGTT pLKO_005 1592 CDS 100% 5.625 3.938 N GGA2 n/a
9 TRCN0000065004 GCTTATCAGATGCTGAAGAAA pLKO.1 761 CDS 100% 5.625 3.938 N GGA2 n/a
10 TRCN0000065007 CTTACGGTACAAGCTGACATT pLKO.1 2053 CDS 100% 4.950 3.465 N GGA2 n/a
11 TRCN0000065005 GCATGGTTTCTGGTCAGAATT pLKO.1 1464 CDS 100% 0.000 0.000 N GGA2 n/a
12 TRCN0000286143 GCATGGTTTCTGGTCAGAATT pLKO_005 1464 CDS 100% 0.000 0.000 N GGA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07834 pDONR223 100% 93.9% 93.8% None 0_1ins111;1159G>C n/a
2 ccsbBroad304_07834 pLX_304 0% 93.9% 93.8% V5 0_1ins111;1159G>C n/a
3 TRCN0000469161 CGATCTATAGTCTGGTGGCTGGAC pLX_317 19% 93.9% 93.8% V5 0_1ins111;1159G>C n/a
Download CSV