Transcript: Human XM_024450210.1

PREDICTED: Homo sapiens mitogen-activated protein kinase 8 interacting protein 3 (MAPK8IP3), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPK8IP3 (23162)
Length:
6461
CDS:
1285..4968

Additional Resources:

NCBI RefSeq record:
XM_024450210.1
NBCI Gene record:
MAPK8IP3 (23162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422388 GTTCTCAGTGCGCGATGATTT pLKO_005 2025 CDS 100% 13.200 18.480 N MAPK8IP3 n/a
2 TRCN0000446931 GCGATGCCGTGAAGTTCTTTG pLKO_005 4664 CDS 100% 10.800 15.120 N MAPK8IP3 n/a
3 TRCN0000037988 TCTGAGCAACTATCACCTAAT pLKO.1 3906 CDS 100% 10.800 15.120 N MAPK8IP3 n/a
4 TRCN0000037987 GCGGAGGATGTAAGCAGCTAT pLKO.1 2308 CDS 100% 4.950 3.960 N MAPK8IP3 n/a
5 TRCN0000433413 ATGCAGATAGAGAAGTCATTT pLKO_005 4030 CDS 100% 13.200 9.240 N MAPK8IP3 n/a
6 TRCN0000037984 GCCTTGAATGTGGTGAAGAAT pLKO.1 2113 CDS 100% 5.625 3.375 N MAPK8IP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07846 pDONR223 100% 83.1% 77.3% None (many diffs) n/a
2 ccsbBroad304_07846 pLX_304 0% 83.1% 77.3% V5 (many diffs) n/a
3 TRCN0000479298 ATAGCGTGTATTCGTCGCACCGGT pLX_317 8.9% 83.1% 77.3% V5 (many diffs) n/a
Download CSV