Transcript: Human XM_024450241.1

PREDICTED: Homo sapiens C-type lectin domain family 18 member C (CLEC18C), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLEC18C (283971)
Length:
1287
CDS:
188..1162

Additional Resources:

NCBI RefSeq record:
XM_024450241.1
NBCI Gene record:
CLEC18C (283971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372982 AGACCACCAACGAGGTGATTG pLKO_005 1141 CDS 100% 10.800 5.400 Y CLEC18C n/a
2 TRCN0000155154 GAACAGGAAGGAGAGTTTCTT pLKO.1 316 CDS 100% 5.625 2.813 Y CLEC18B n/a
3 TRCN0000161377 GAACAGGAAGGAGAGTTTCTT pLKO.1 316 CDS 100% 5.625 2.813 Y CLEC18A n/a
4 TRCN0000156449 CCTGAACAGGAAGGAGAGTTT pLKO.1 313 CDS 100% 4.950 2.475 Y CLEC18B n/a
5 TRCN0000162824 CGAGGTGATTGACAGTGACTT pLKO.1 1151 CDS 100% 4.950 2.475 Y CLEC18A n/a
6 TRCN0000156890 GAAGTGGTCAGCCTATGGTTT pLKO.1 551 CDS 100% 4.950 2.475 Y CLEC18B n/a
7 TRCN0000163010 GAAGTGGTCAGCCTATGGTTT pLKO.1 551 CDS 100% 4.950 2.475 Y CLEC18A n/a
8 TRCN0000157176 GAAGGAGAGTTTCTTGCTCCT pLKO.1 322 CDS 100% 0.216 0.108 Y CLEC18B n/a
9 TRCN0000163539 GAAGGAGAGTTTCTTGCTCCT pLKO.1 322 CDS 100% 0.216 0.108 Y CLEC18A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13508 pDONR223 100% 78.3% 72.8% None (many diffs) n/a
2 ccsbBroad304_13508 pLX_304 0% 78.3% 72.8% V5 (many diffs) n/a
3 TRCN0000471241 ATCATCACAACCTTTCGCCCATAC pLX_317 48.2% 78.3% 72.8% V5 (many diffs) n/a
4 ccsbBroadEn_10057 pDONR223 100% 72.1% 65.4% None (many diffs) n/a
5 ccsbBroad304_10057 pLX_304 0% 72.1% 65.4% V5 (many diffs) n/a
6 TRCN0000472938 GACTAAGCATTGCTCAGGGTACCC pLX_317 22.1% 72.1% 65.4% V5 (many diffs) n/a
Download CSV