Transcript: Human XM_024450448.1

PREDICTED: Homo sapiens armadillo repeat containing 5 (ARMC5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMC5 (79798)
Length:
3877
CDS:
678..3599

Additional Resources:

NCBI RefSeq record:
XM_024450448.1
NBCI Gene record:
ARMC5 (79798)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427340 AGTACGCGAGGGAACCATTCT pLKO_005 1661 CDS 100% 4.950 6.930 N ARMC5 n/a
2 TRCN0000423932 CTATGTCGTGAGGCCATCAAC pLKO_005 1836 CDS 100% 4.950 6.930 N ARMC5 n/a
3 TRCN0000153937 CAAGGATGAATTGGCTGTGAA pLKO.1 3628 3UTR 100% 4.950 3.960 N ARMC5 n/a
4 TRCN0000156262 CCCTTTGGTGACCATTCTTCA pLKO.1 1241 CDS 100% 4.950 3.465 N ARMC5 n/a
5 TRCN0000157871 CCTGTCCTGCATCATTTGCAT pLKO.1 3195 CDS 100% 3.000 2.100 N ARMC5 n/a
6 TRCN0000156643 GAAGACAGACAGCATCCAGAA pLKO.1 1268 CDS 100% 4.050 2.430 N ARMC5 n/a
7 TRCN0000156769 GTGCATGAAGACAGACAGCAT pLKO.1 1262 CDS 100% 2.640 1.584 N ARMC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12618 pDONR223 100% 79.2% 79.2% None 1_588del;2093_2110del n/a
2 ccsbBroad304_12618 pLX_304 0% 79.2% 79.2% V5 1_588del;2093_2110del n/a
3 TRCN0000475110 TGCGACTAACCGTGGCAGGCCAGT pLX_317 16.5% 79.2% 79.2% V5 1_588del;2093_2110del n/a
Download CSV