Transcript: Human XM_024450881.1

PREDICTED: Homo sapiens dynein axonemal intermediate chain 2 (DNAI2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAI2 (64446)
Length:
2314
CDS:
128..1963

Additional Resources:

NCBI RefSeq record:
XM_024450881.1
NBCI Gene record:
DNAI2 (64446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415337 GAAGGAGGCAGACGCCATAAA pLKO_005 1699 CDS 100% 13.200 18.480 N DNAI2 n/a
2 TRCN0000425667 ATCATGCAGCTCGGCTCTATC pLKO_005 455 CDS 100% 10.800 15.120 N DNAI2 n/a
3 TRCN0000116369 CGAATCTACTTTGCCCACCAA pLKO.1 988 CDS 100% 2.640 3.696 N DNAI2 n/a
4 TRCN0000421727 GGCATACTCCTGCTTGGATTT pLKO_005 667 CDS 100% 10.800 7.560 N DNAI2 n/a
5 TRCN0000426194 GGCATGAGCAGCGATTCATAC pLKO_005 704 CDS 100% 10.800 7.560 N DNAI2 n/a
6 TRCN0000116370 CACTGCATCAAGCAGAACAAT pLKO.1 482 CDS 100% 5.625 3.938 N DNAI2 n/a
7 TRCN0000116367 CCTACAAATCAGGAACAGAAA pLKO.1 2114 3UTR 100% 4.950 3.465 N DNAI2 n/a
8 TRCN0000116368 GCACTGCATCAAGCAGAACAA pLKO.1 481 CDS 100% 4.950 3.465 N DNAI2 n/a
9 TRCN0000116371 CAGAGGAATGAGAAGAACGTA pLKO.1 1478 CDS 100% 3.000 2.100 N DNAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08856 pDONR223 100% 85.4% 85.3% None (many diffs) n/a
2 ccsbBroad304_08856 pLX_304 0% 85.4% 85.3% V5 (many diffs) n/a
3 TRCN0000469140 GGTCTTACCACGACGTACAGTCGA pLX_317 23.4% 85.4% 85.3% V5 (many diffs) n/a
Download CSV