Transcript: Human XM_024450943.1

PREDICTED: Homo sapiens matrix metallopeptidase 28 (MMP28), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MMP28 (79148)
Length:
2114
CDS:
164..1471

Additional Resources:

NCBI RefSeq record:
XM_024450943.1
NBCI Gene record:
MMP28 (79148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051595 GCGTAAGAAACGCTTTGCAAA pLKO.1 262 CDS 100% 4.950 6.930 N MMP28 n/a
2 TRCN0000051597 GCATTCCTAGAGAAGTACGGA pLKO.1 20 5UTR 100% 0.750 1.050 N MMP28 n/a
3 TRCN0000373057 CTGAAACGCAGGGCCCTAAAT pLKO_005 855 CDS 100% 13.200 10.560 N MMP28 n/a
4 TRCN0000051593 GCAAGGTAACAAATGGTACAA pLKO.1 283 CDS 100% 4.950 3.960 N MMP28 n/a
5 TRCN0000378844 GGCAACAGCAACTGTACATTT pLKO_005 912 CDS 100% 13.200 9.240 N MMP28 n/a
6 TRCN0000373058 GCCTTTGTTTCTTCGGCTAAA pLKO_005 1753 3UTR 100% 10.800 7.560 N MMP28 n/a
7 TRCN0000051594 GCGGCAGTGTCATTGAATGAT pLKO.1 1034 CDS 100% 5.625 3.938 N MMP28 n/a
8 TRCN0000051596 TCCATCATCTTCTTCCGAGAT pLKO.1 1334 CDS 100% 4.050 2.835 N MMP28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12549 pDONR223 100% 59% 58.4% None (many diffs) n/a
2 ccsbBroad304_12549 pLX_304 0% 59% 58.4% V5 (many diffs) n/a
3 TRCN0000466388 CTCATTATCTAAGCCTCTACTTTC pLX_317 34.1% 59% 58.4% V5 (many diffs) n/a
Download CSV