Transcript: Human XM_024450948.1

PREDICTED: Homo sapiens fructosamine 3 kinase related protein (FN3KRP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FN3KRP (79672)
Length:
1944
CDS:
526..1098

Additional Resources:

NCBI RefSeq record:
XM_024450948.1
NBCI Gene record:
FN3KRP (79672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052552 CAAGGACGAGTGTTCGTGAAA pLKO.1 24 5UTR 100% 4.950 6.930 N FN3KRP n/a
2 TRCN0000174174 CAAGGACGAGTGTTCGTGAAA pLKO.1 24 5UTR 100% 4.950 6.930 N FN3KRP n/a
3 TRCN0000052549 CTCGGAATATGAGCTGGCAAT pLKO.1 891 CDS 100% 4.050 5.670 N FN3KRP n/a
4 TRCN0000052551 CTTGAACCACTGGAATCATTT pLKO.1 1023 CDS 100% 13.200 9.240 N FN3KRP n/a
5 TRCN0000199718 GTATGAGCAGAGGGATGTATG pLKO.1 1316 3UTR 100% 10.800 7.560 N FN3KRP n/a
6 TRCN0000052548 TGGCCGATTTACACCTTGATA pLKO.1 488 5UTR 100% 5.625 3.938 N FN3KRP n/a
7 TRCN0000194844 CAATTCCAGAATCAAGCGTAT pLKO.1 1598 3UTR 100% 4.050 2.835 N FN3KRP n/a
8 TRCN0000052550 CGGAGCTACGACACGGATCAA pLKO.1 6 5UTR 100% 1.650 1.155 N FN3KRP n/a
9 TRCN0000174173 CGGAGCTACGACACGGATCAA pLKO.1 6 5UTR 100% 1.650 1.155 N FN3KRP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04105 pDONR223 100% 61.4% 61.4% None 0_1ins357 n/a
2 ccsbBroad304_04105 pLX_304 0% 61.4% 61.4% V5 0_1ins357 n/a
3 TRCN0000472673 TAGCCTAGTGAACTATCGACAGGA pLX_317 39% 61.4% 61.4% V5 0_1ins357 n/a
4 ccsbBroadEn_15149 pDONR223 0% 61.4% 61.4% None 0_1ins357 n/a
5 ccsbBroad304_15149 pLX_304 0% 61.4% 61.4% V5 0_1ins357 n/a
6 TRCN0000474190 GTAATTAAAGATTTTCAGTGGGGG pLX_317 44.3% 61.4% 61.4% V5 0_1ins357 n/a
Download CSV