Transcript: Human XM_024451144.1

PREDICTED: Homo sapiens tubulin beta 8B (TUBB8B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TUBB8B (260334)
Length:
2532
CDS:
1058..2239

Additional Resources:

NCBI RefSeq record:
XM_024451144.1
NBCI Gene record:
TUBB8B (260334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116637 GCCACCTTCATTGGGAATAAT pLKO.1 1997 CDS 100% 15.000 7.500 Y TUBB8 n/a
2 TRCN0000116638 CCAGCAGATGTTTGATGCTAA pLKO.1 1774 CDS 100% 4.950 2.475 Y TUBB8 n/a
3 TRCN0000116876 GCATAGATAACGAAGCGCTAT pLKO.1 1506 CDS 100% 4.050 2.025 Y TUBB7P n/a
4 TRCN0000116640 CCCAGCAGATGTTTGATGCTA pLKO.1 1773 CDS 100% 3.000 1.500 Y TUBB8 n/a
5 TRCN0000116641 GCCGTGAACATGGTCCCGTTT pLKO.1 1664 CDS 100% 1.350 0.675 Y TUBB8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02416 pDONR223 100% 71.8% 53.8% None (many diffs) n/a
2 ccsbBroad304_02416 pLX_304 0% 71.8% 53.8% V5 (many diffs) n/a
3 TRCN0000466709 TCTCGCAGGACAGTTCGGCCAACT pLX_317 32.4% 71.8% 53.8% V5 (many diffs) n/a
Download CSV