Transcript: Human XM_024451160.1

PREDICTED: Homo sapiens calcium binding tyrosine phosphorylation regulated (CABYR), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CABYR (26256)
Length:
2290
CDS:
110..1591

Additional Resources:

NCBI RefSeq record:
XM_024451160.1
NBCI Gene record:
CABYR (26256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365494 TTTATCTTAGTAGGCTCAAAT pLKO_005 1844 3UTR 100% 13.200 18.480 N CABYR n/a
2 TRCN0000054207 GCTCTCTGACACATCTTTGAA pLKO.1 1267 CDS 100% 5.625 4.500 N CABYR n/a
3 TRCN0000054203 CCACCCAGTTTCCATCAGTTT pLKO.1 465 CDS 100% 4.950 3.960 N CABYR n/a
4 TRCN0000365434 GGAATACTACTATGGATATAA pLKO_005 255 CDS 100% 15.000 10.500 N CABYR n/a
5 TRCN0000370543 ACTGCCAGAACAAATAGTTAT pLKO_005 1042 CDS 100% 13.200 9.240 N CABYR n/a
6 TRCN0000370619 AGGCCTTACTGCACCAGAAAT pLKO_005 1540 CDS 100% 13.200 9.240 N CABYR n/a
7 TRCN0000376597 GATTTGGGTTCTCAACCTAAA pLKO_005 839 CDS 100% 10.800 7.560 N CABYR n/a
8 TRCN0000054204 GCAGGCTGATATTGAGGTTAT pLKO.1 952 CDS 100% 10.800 7.560 N CABYR n/a
9 TRCN0000370618 TGAGCAGTCACCACGAGTTAG pLKO_005 1117 CDS 100% 10.800 7.560 N CABYR n/a
10 TRCN0000054206 GCTCAGATGTTAGGTAAAGTT pLKO.1 638 CDS 100% 5.625 3.938 N CABYR n/a
11 TRCN0000054205 CCATCAAACATCAACCAGTTT pLKO.1 197 CDS 100% 4.950 3.465 N CABYR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08007 pDONR223 100% 59.3% 42.1% None (many diffs) n/a
2 ccsbBroad304_08007 pLX_304 0% 59.3% 42.1% V5 (many diffs) n/a
3 TRCN0000468753 TCCGTATTGGTCCCTTTAACAATA pLX_317 42.6% 59.3% 42.1% V5 (many diffs) n/a
Download CSV