Transcript: Human XM_024451224.1

PREDICTED: Homo sapiens spire type actin nucleation factor 1 (SPIRE1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPIRE1 (56907)
Length:
5654
CDS:
444..2528

Additional Resources:

NCBI RefSeq record:
XM_024451224.1
NBCI Gene record:
SPIRE1 (56907)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365786 ATCTCAGCTATTCGGTCATAT pLKO_005 651 CDS 100% 13.200 18.480 N SPIRE1 n/a
2 TRCN0000370936 AGTGGAATGCCTCGCTCTTAC pLKO_005 1913 CDS 100% 10.800 15.120 N SPIRE1 n/a
3 TRCN0000219870 CTTTACTGTTCCTCGAATAAT pLKO.1 2819 3UTR 100% 15.000 12.000 N SPIRE1 n/a
4 TRCN0000370937 CAAGAAGTTCATTTCGGAAAT pLKO_005 2372 CDS 100% 10.800 8.640 N SPIRE1 n/a
5 TRCN0000365715 GTGGAAGAAGTGATGCATATT pLKO_005 1935 CDS 100% 13.200 9.240 N SPIRE1 n/a
6 TRCN0000370935 ACTGAATCAGATGCACCAAAT pLKO_005 708 CDS 100% 10.800 7.560 N SPIRE1 n/a
7 TRCN0000168532 CAAAGAATCTTGTGGAGTCAT pLKO.1 1336 CDS 100% 4.950 3.465 N SPIRE1 n/a
8 TRCN0000168422 GAAAGTAGTATGAGGTCAGAA pLKO.1 2205 CDS 100% 4.950 3.465 N SPIRE1 n/a
9 TRCN0000167580 GAGATGTTAATGGATGACATT pLKO.1 1002 CDS 100% 4.950 3.465 N SPIRE1 n/a
10 TRCN0000365714 TGATGGTGAATGGTGATATTC pLKO_005 1051 CDS 100% 13.200 7.920 N SPIRE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12310 pDONR223 100% 18.8% 18.8% None 1_1689del n/a
2 ccsbBroad304_12310 pLX_304 0% 18.8% 18.8% V5 1_1689del n/a
3 TRCN0000472607 ACGGTGAGGGCTGTTAGTCCAACG pLX_317 100% 18.8% 18.8% V5 1_1689del n/a
Download CSV