Transcript: Human XM_024451227.1

PREDICTED: Homo sapiens leucine rich repeats and immunoglobulin like domains 2 (LRIG2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRIG2 (9860)
Length:
11344
CDS:
297..3185

Additional Resources:

NCBI RefSeq record:
XM_024451227.1
NBCI Gene record:
LRIG2 (9860)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434708 ATGCCTAAAGAGACATATTTA pLKO_005 2808 CDS 100% 15.000 21.000 N LRIG2 n/a
2 TRCN0000429135 TTACAAGGAAACCAGATTAAG pLKO_005 1164 CDS 100% 13.200 18.480 N LRIG2 n/a
3 TRCN0000152196 CCGAACTTGATTTGTCCTATA pLKO.1 928 CDS 100% 10.800 15.120 N LRIG2 n/a
4 TRCN0000420391 TTAGTAGGACTCGGAACATTC pLKO_005 3142 CDS 100% 10.800 15.120 N LRIG2 n/a
5 TRCN0000151448 CAGTCATAATCGGTTGTCTAA pLKO.1 233 5UTR 100% 4.950 6.930 N LRIG2 n/a
6 TRCN0000415457 GAAACTCCGAAGTCAGCATTT pLKO_005 3258 3UTR 100% 10.800 8.640 N LRIG2 n/a
7 TRCN0000427113 ATCTGGGCAGAGACTTATTAA pLKO_005 3204 3UTR 100% 15.000 10.500 N LRIG2 n/a
8 TRCN0000426821 GCTGGTTGCTTCGATAATTTA pLKO_005 537 CDS 100% 15.000 10.500 N LRIG2 n/a
9 TRCN0000416722 CATATTGCTGATGGTGTATTT pLKO_005 1032 CDS 100% 13.200 9.240 N LRIG2 n/a
10 TRCN0000152310 CATGCGTTGTTTGGTCTTATA pLKO.1 3325 3UTR 100% 13.200 9.240 N LRIG2 n/a
11 TRCN0000154082 CCATGCGTTGTTTGGTCTTAT pLKO.1 3324 3UTR 100% 13.200 9.240 N LRIG2 n/a
12 TRCN0000154308 CCACCAACCATGAGAGGATAA pLKO.1 2902 CDS 100% 10.800 7.560 N LRIG2 n/a
13 TRCN0000155587 CCTGGGATTCTTCAGTGGTTT pLKO.1 3621 3UTR 100% 4.950 3.465 N LRIG2 n/a
14 TRCN0000155196 GCCATGCGTTGTTTGGTCTTA pLKO.1 3323 3UTR 100% 4.950 3.465 N LRIG2 n/a
15 TRCN0000155255 GCTGTGTTGTTGGCACTTCTT pLKO.1 2431 CDS 100% 4.950 3.465 N LRIG2 n/a
16 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 10134 3UTR 100% 13.200 6.600 Y CLDN18 n/a
17 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3980 3UTR 100% 4.950 2.475 Y ERN2 n/a
18 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3980 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3980 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 8142 3UTR 100% 4.950 2.475 Y ERAP2 n/a
21 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 10239 3UTR 100% 4.950 2.475 Y LOC387873 n/a
22 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 8143 3UTR 100% 13.200 6.600 Y LIAS n/a
23 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6573 3UTR 100% 5.625 2.813 Y KLHL30 n/a
24 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6573 3UTR 100% 5.625 2.813 Y EID2B n/a
25 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8617 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.