Transcript: Human XM_024451236.1

PREDICTED: Homo sapiens GRB2 associated regulator of MAPK1 subtype 1 (GAREM1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAREM1 (64762)
Length:
7180
CDS:
569..2830

Additional Resources:

NCBI RefSeq record:
XM_024451236.1
NBCI Gene record:
GAREM1 (64762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426148 GTTCGACATCGATGAGTATTC pLKO_005 1201 CDS 100% 10.800 15.120 N GAREM1 n/a
2 TRCN0000136021 GCACCGCTATAAGTTTGTGAA pLKO.1 1006 CDS 100% 4.950 6.930 N GAREM1 n/a
3 TRCN0000138146 GCCTTGTACGTCACTCAACAA pLKO.1 3039 3UTR 100% 4.950 6.930 N GAREM1 n/a
4 TRCN0000135637 GCTACACAACATCGTCACTAA pLKO.1 1924 CDS 100% 4.950 6.930 N GAREM1 n/a
5 TRCN0000136049 GCTTCAGGTGAATGCAATGAA pLKO.1 599 CDS 100% 5.625 4.500 N GAREM1 n/a
6 TRCN0000415739 AGAACAGATGTGATCAGTTTA pLKO_005 1626 CDS 100% 13.200 9.240 N GAREM1 n/a
7 TRCN0000427905 TGACTATCTGCTGATTCATTC pLKO_005 237 5UTR 100% 10.800 7.560 N GAREM1 n/a
8 TRCN0000135065 CTGGGACACAATTTCATGTTT pLKO.1 2892 3UTR 100% 5.625 3.938 N GAREM1 n/a
9 TRCN0000138004 GCAGCAGTGAAGTCTTCAGAT pLKO.1 1706 CDS 100% 4.950 2.970 N GAREM1 n/a
10 TRCN0000138478 CCTTCTGAAAGCACTCCTGTT pLKO.1 1958 CDS 100% 4.050 2.430 N GAREM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451236.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12483 pDONR223 100% 85.9% 85.9% None 0_1ins366;1367_1368insCAG n/a
2 ccsbBroadEn_12484 pDONR223 100% 78% 78% None 0_1ins366;1116_1322del;1367_1368insCAG n/a
3 TRCN0000492035 TACGCTATCTCAAATTAAGCATGT pLX_317 14.3% 78% 78% V5 0_1ins366;1116_1322del;1367_1368insCAG n/a
Download CSV