Transcript: Human XM_024451286.1

PREDICTED: Homo sapiens protein inhibitor of activated STAT 2 (PIAS2), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIAS2 (9063)
Length:
5877
CDS:
129..1640

Additional Resources:

NCBI RefSeq record:
XM_024451286.1
NBCI Gene record:
PIAS2 (9063)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013352 CGAGTTTAGTTCAAAGCAGTA pLKO.1 592 CDS 100% 4.050 5.670 N PIAS2 n/a
2 TRCN0000013349 CCACAATCAAATCATCGGTTT pLKO.1 328 CDS 100% 4.050 3.240 N PIAS2 n/a
3 TRCN0000230128 ATCATTCCAGAGCACTAATTA pLKO_005 1051 CDS 100% 15.000 10.500 N PIAS2 n/a
4 TRCN0000428983 ATCATTCCAGAGCACTAATTA pLKO_005 1051 CDS 100% 15.000 10.500 N Pias2 n/a
5 TRCN0000422690 CTTACATCAGCCATGTTATTA pLKO_005 996 CDS 100% 15.000 10.500 N Pias2 n/a
6 TRCN0000230127 GGCTTTGCTGGACGGAATAAA pLKO_005 171 CDS 100% 15.000 10.500 N PIAS2 n/a
7 TRCN0000431539 CTCATCAAGCCCACGAGTTTA pLKO_005 579 CDS 100% 13.200 9.240 N Pias2 n/a
8 TRCN0000013348 GCCATGTTATTACAGAGATTA pLKO.1 1005 CDS 100% 13.200 9.240 N PIAS2 n/a
9 TRCN0000435253 GCCCTCAAGAAGATAACTATC pLKO_005 760 CDS 100% 10.800 7.560 N Pias2 n/a
10 TRCN0000013350 GCAAGCAAGAAGAAAGTAGAT pLKO.1 1485 CDS 100% 4.950 3.465 N PIAS2 n/a
11 TRCN0000218049 ACTTGATTCTGGGAATCATTC pLKO_005 1841 3UTR 100% 1.080 0.756 N PIAS2 n/a
12 TRCN0000218814 AGACTGCAACAAGAACCAAAT pLKO_005 1984 3UTR 100% 10.800 6.480 N PIAS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07353 pDONR223 100% 87.7% 86.7% None (many diffs) n/a
2 ccsbBroad304_07353 pLX_304 0% 87.7% 86.7% V5 (many diffs) n/a
3 TRCN0000477220 TCTAACTGATGACGTACAGTGCGC pLX_317 23.2% 87.7% 86.7% V5 (many diffs) n/a
Download CSV