Transcript: Human XM_024451298.1

PREDICTED: Homo sapiens lysophosphatidylglycerol acyltransferase 1 (LPGAT1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LPGAT1 (9926)
Length:
6166
CDS:
135..1247

Additional Resources:

NCBI RefSeq record:
XM_024451298.1
NBCI Gene record:
LPGAT1 (9926)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296360 CTCTTAGCTGTAGTCTATATT pLKO_005 1615 3UTR 100% 15.000 12.000 N LPGAT1 n/a
2 TRCN0000116062 CGGTGAATAAATGAAACCAAT pLKO.1 3324 3UTR 100% 4.950 3.960 N LPGAT1 n/a
3 TRCN0000116063 GCGAGAAACAAGTCAGGCATT pLKO.1 707 CDS 100% 4.050 3.240 N LPGAT1 n/a
4 TRCN0000289891 GCGAGAAACAAGTCAGGCATT pLKO_005 707 CDS 100% 4.050 3.240 N LPGAT1 n/a
5 TRCN0000116066 GTTCATGGAGACTTCTTTATA pLKO.1 561 CDS 100% 15.000 10.500 N LPGAT1 n/a
6 TRCN0000289966 GTTCATGGAGACTTCTTTATA pLKO_005 561 CDS 100% 15.000 10.500 N LPGAT1 n/a
7 TRCN0000296361 TGTGGTTGATGGATCATATTT pLKO_005 508 CDS 100% 15.000 10.500 N LPGAT1 n/a
8 TRCN0000116064 GCAGTGATGTTGGTGAATCAT pLKO.1 417 CDS 100% 5.625 3.938 N LPGAT1 n/a
9 TRCN0000289892 GCAGTGATGTTGGTGAATCAT pLKO_005 417 CDS 100% 5.625 3.938 N LPGAT1 n/a
10 TRCN0000116065 GCTAAAGAATTAGACAGCAAA pLKO.1 849 CDS 100% 4.950 3.465 N LPGAT1 n/a
11 TRCN0000125610 CCATCCTACATCTGCTATGTA pLKO.1 234 CDS 100% 0.563 0.394 N Lpgat1 n/a
12 TRCN0000323921 CCATCCTACATCTGCTATGTA pLKO_005 234 CDS 100% 0.563 0.394 N Lpgat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02271 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02271 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468411 CCGTTCTCCAGATTTACGTCCACG pLX_317 41.5% 99.8% 99.7% V5 652_653delACinsCA n/a
Download CSV