Transcript: Human XM_024451394.1

PREDICTED: Homo sapiens zinc finger protein 558 (ZNF558), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF558 (148156)
Length:
3758
CDS:
973..2181

Additional Resources:

NCBI RefSeq record:
XM_024451394.1
NBCI Gene record:
ZNF558 (148156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232909 TCACTAGGGTGTCGTGTTAAT pLKO_005 1213 CDS 100% 13.200 18.480 N ZNF558 n/a
2 TRCN0000019403 CGTGGAGTGAAACTCAATGAA pLKO.1 1411 CDS 100% 5.625 7.875 N ZNF558 n/a
3 TRCN0000019399 CGCACCAGTTGTAACCTCAAA pLKO.1 1708 CDS 100% 4.950 6.930 N ZNF558 n/a
4 TRCN0000232911 ATCGTGGAGTGAAACTCAATG pLKO_005 1409 CDS 100% 10.800 8.640 N ZNF558 n/a
5 TRCN0000232910 ACCAAGCACCTGTCCAGATTT pLKO_005 1299 CDS 100% 13.200 9.240 N ZNF558 n/a
6 TRCN0000019401 CTGGGCACAATAGCATTCATA pLKO.1 1811 CDS 100% 5.625 3.938 N ZNF558 n/a
7 TRCN0000019402 CCAGTTGGAACAAGACAAGAA pLKO.1 1251 CDS 100% 4.950 3.465 N ZNF558 n/a
8 TRCN0000019400 CCTCATCCCTTAGACTGCATT pLKO.1 1631 CDS 100% 4.950 3.465 N ZNF558 n/a
9 TRCN0000232913 AGAGCTCACACTGGATATATA pLKO_005 2244 3UTR 100% 15.000 9.000 N ZNF558 n/a
10 TRCN0000232912 CTCTCTCACTGGGCACAATAG pLKO_005 1803 CDS 100% 10.800 6.480 N ZNF558 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05008 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05008 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469198 TATCGTGGTACGAGGAAACTTGAT pLX_317 31.7% 100% 100% V5 n/a
Download CSV