Transcript: Human XM_024451404.1

PREDICTED: Homo sapiens podoplanin (PDPN), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDPN (10630)
Length:
2491
CDS:
83..445

Additional Resources:

NCBI RefSeq record:
XM_024451404.1
NBCI Gene record:
PDPN (10630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061924 GCTATAAGTCTGGCTTGACAA pLKO.1 132 CDS 100% 4.950 6.930 N PDPN n/a
2 TRCN0000415864 AGGCATTCGCATCGAGGATCT pLKO_005 184 CDS 100% 4.050 5.670 N PDPN n/a
3 TRCN0000061925 CGGCTTCATTGGTGCAATCAT pLKO.1 382 CDS 100% 5.625 4.500 N PDPN n/a
4 TRCN0000061923 GCCTCTGGTATGAGAAATAAA pLKO.1 1417 3UTR 100% 15.000 10.500 N PDPN n/a
5 TRCN0000434625 AGTCCACGCGCAAGAACAAAG pLKO_005 223 CDS 100% 10.800 7.560 N PDPN n/a
6 TRCN0000423088 TGACCCTGGTTGGAATCATAG pLKO_005 342 CDS 100% 10.800 7.560 N PDPN n/a
7 TRCN0000426696 CCTAAAGAGCTGAAGGGTTAC pLKO_005 441 CDS 100% 6.000 4.200 N PDPN n/a
8 TRCN0000061927 GCAACAAGTGTCAACAGTGTA pLKO.1 161 CDS 100% 4.950 3.465 N PDPN n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2162 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2162 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11532 pDONR223 100% 73.8% 73.4% None 0_1ins126;314C>G n/a
2 ccsbBroad304_11532 pLX_304 0% 73.8% 73.4% V5 0_1ins126;314C>G n/a
3 TRCN0000472535 AGGTTCTACTCCATGTTTAAATCA pLX_317 93.4% 73.8% 73.4% V5 0_1ins126;314C>G n/a
Download CSV