Transcript: Human XM_024451447.1

PREDICTED: Homo sapiens ferritin light chain (FTL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FTL (2512)
Length:
1182
CDS:
1..1038

Additional Resources:

NCBI RefSeq record:
XM_024451447.1
NBCI Gene record:
FTL (2512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437490 AGCCACTTCTTCCGCGAATTG pLKO_005 655 CDS 100% 10.800 15.120 N FTL n/a
2 TRCN0000029438 GCTCACTCTCAAGCACGACTA pLKO.1 1017 CDS 100% 4.050 3.240 N FTL n/a
3 TRCN0000421869 ACCTCTCTCTGGGCTTCTATT pLKO_005 602 CDS 100% 13.200 9.240 N FTL n/a
4 TRCN0000423730 AGGAAGTGAAGCTTATCAAGA pLKO_005 920 CDS 100% 4.950 3.465 N FTL n/a
5 TRCN0000029434 CTGGAGACTCACTTCCTAGAT pLKO.1 898 CDS 100% 4.950 3.465 N FTL n/a
6 TRCN0000029436 GACATCAAGAAGCCAGCTGAA pLKO.1 751 CDS 100% 4.050 2.835 N FTL n/a
7 TRCN0000029437 CCTGGTCAATTTGTACCTGCA pLKO.1 567 CDS 100% 2.160 1.512 N FTL n/a
8 TRCN0000436598 CTTCTGAGCCCAGCGACTTCT pLKO_005 1043 3UTR 100% 1.650 1.155 N FTL n/a
9 TRCN0000029435 CGCGATGATGTGGCTCTGGAA pLKO.1 628 CDS 100% 0.880 0.616 N FTL n/a
10 TRCN0000258043 TACCTCTCTCTGGGCTTCTTT pLKO_005 601 CDS 100% 0.000 0.000 N Ftl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00594 pDONR223 100% 50.7% 50.7% None 1_510del n/a
2 ccsbBroad304_00594 pLX_304 0% 50.7% 50.7% V5 1_510del n/a
3 TRCN0000471307 CGGGGGCATCATTGAAGAAAGTCA pLX_317 80% 50.7% 50.7% V5 1_510del n/a
4 ccsbBroadEn_06227 pDONR223 100% 50.6% 50.4% None 1_510del;745T>C n/a
5 ccsbBroad304_06227 pLX_304 0% 50.6% 50.4% V5 1_510del;745T>C n/a
6 ccsbBroadEn_15418 pDONR223 0% 50.6% 50.7% None 1_510del;673T>C n/a
7 ccsbBroad304_15418 pLX_304 0% 50.6% 50.7% V5 1_510del;673T>C n/a
8 ccsbBroadEn_06226 pDONR223 100% 50.5% 50.4% None 1_510del;673T>C;761A>N n/a
9 ccsbBroad304_06226 pLX_304 0% 50.5% 50.4% V5 1_510del;673T>C;761A>N n/a
10 TRCN0000470657 CTTACCGTACTACTGTAATCAAAC pLX_317 84.9% 50.5% 50.1% V5 1_510del;731G>T;754A>G n/a
11 ccsbBroadEn_15419 pDONR223 0% 50.5% 50.4% None 1_510del;673T>C;884A>G n/a
12 ccsbBroad304_15419 pLX_304 0% 50.5% 50.4% V5 1_510del;673T>C;884A>G n/a
13 ccsbBroadEn_15420 pDONR223 0% 29.2% 26% None (many diffs) n/a
14 ccsbBroad304_15420 pLX_304 0% 29.2% 26% V5 (many diffs) n/a
15 TRCN0000480687 GACTATGGGCACATCACGTTTGAG pLX_317 100% 29.2% 26% V5 (many diffs) n/a
Download CSV