Transcript: Human XM_024451879.1

PREDICTED: Homo sapiens transmembrane protein 230 (TMEM230), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM230 (29058)
Length:
1234
CDS:
64..636

Additional Resources:

NCBI RefSeq record:
XM_024451879.1
NBCI Gene record:
TMEM230 (29058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275146 CCCTCCTAAGATCCCTTATAA pLKO_005 363 CDS 100% 15.000 10.500 N TMEM230 n/a
2 TRCN0000131231 GACGATGGCTACATTGACCTT pLKO.1 328 CDS 100% 2.640 1.848 N TMEM230 n/a
3 TRCN0000275096 GACGATGGCTACATTGACCTT pLKO_005 328 CDS 100% 2.640 1.848 N TMEM230 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08101 pDONR223 100% 46.3% 40.1% None (many diffs) n/a
2 ccsbBroad304_08101 pLX_304 0% 46.3% 40.1% V5 (many diffs) n/a
3 TRCN0000468750 GCGGACCAATCTGGGAATACGTAT pLX_317 100% 46.3% 40.1% V5 (many diffs) n/a
4 ccsbBroadEn_03066 pDONR223 100% 46% 40.1% None (many diffs) n/a
5 ccsbBroadEn_15802 pDONR223 0% 45.8% 40.1% None (many diffs) n/a
6 ccsbBroad304_15802 pLX_304 0% 45.8% 40.1% V5 (many diffs) n/a
7 TRCN0000474148 ACACACTCTCCGAGCACACATGGC pLX_317 100% 45.6% 39.7% V5 (many diffs) n/a
Download CSV