Transcript: Human XM_024451956.1

PREDICTED: Homo sapiens RB transcriptional corepressor like 1 (RBL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBL1 (5933)
Length:
5800
CDS:
73..3390

Additional Resources:

NCBI RefSeq record:
XM_024451956.1
NBCI Gene record:
RBL1 (5933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417052 ACTGACCGGACGGAGATATTT pLKO_005 1293 CDS 100% 15.000 21.000 N RBL1 n/a
2 TRCN0000425373 GACTTGCTAAATCCATCATTT pLKO_005 844 CDS 100% 13.200 18.480 N RBL1 n/a
3 TRCN0000040019 CCAAGCTAATAGTCACGTATA pLKO.1 2799 CDS 100% 10.800 15.120 N RBL1 n/a
4 TRCN0000427023 GAGAACCAAGAAGCGAGTAAT pLKO_005 3261 CDS 100% 13.200 9.240 N RBL1 n/a
5 TRCN0000436421 TGCACCAAGTGACCAACTTAT pLKO_005 1401 CDS 100% 13.200 9.240 N RBL1 n/a
6 TRCN0000010404 CATCGATAGTGATGCAGAATC pLKO.1 3285 CDS 100% 10.800 7.560 N RBL1 n/a
7 TRCN0000040020 GCAGTGAATAAGGAGTATGAA pLKO.1 1084 CDS 100% 5.625 3.938 N RBL1 n/a
8 TRCN0000010405 AGTTGGAGCTCTGTCCTTCAA pLKO.1 3440 3UTR 100% 4.950 3.465 N RBL1 n/a
9 TRCN0000040022 GCACAGGCTAATGTGGAGTAT pLKO.1 1222 CDS 100% 4.950 3.465 N RBL1 n/a
10 TRCN0000040021 CCAGAATACTACGTTCAGCTA pLKO.1 335 CDS 100% 2.640 1.848 N RBL1 n/a
11 TRCN0000040018 CCCACTGTGGTAATTCCACAT pLKO.1 4167 3UTR 100% 0.405 0.284 N RBL1 n/a
12 TRCN0000180546 GCCTGTAATCCCAGGACTTTA pLKO.1 3646 3UTR 100% 13.200 6.600 Y PRR11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451956.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13940 pDONR223 100% 91.7% .7% None (many diffs) n/a
2 ccsbBroad304_13940 pLX_304 0% 91.7% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478961 GAAAGCGCCTCCCTATTTAAGAGC pLX_317 13.2% 91.7% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV