Transcript: Human XM_024452064.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 25 (USP25), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP25 (29761)
Length:
4796
CDS:
627..3212

Additional Resources:

NCBI RefSeq record:
XM_024452064.1
NBCI Gene record:
USP25 (29761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004369 GCGTGAGCTGAGGTATCTATT pLKO.1 577 5UTR 100% 13.200 18.480 N USP25 n/a
2 TRCN0000318645 GCGTGAGCTGAGGTATCTATT pLKO_005 577 5UTR 100% 13.200 18.480 N USP25 n/a
3 TRCN0000004366 GCACTTCTCCTGTTGACGATA pLKO.1 1228 CDS 100% 4.950 6.930 N USP25 n/a
4 TRCN0000318646 GCACTTCTCCTGTTGACGATA pLKO_005 1228 CDS 100% 4.950 6.930 N USP25 n/a
5 TRCN0000004370 TGGAGGAGTAAGATGAAATAT pLKO.1 4519 3UTR 100% 15.000 10.500 N USP25 n/a
6 TRCN0000004367 GCTGTAGAAGATATGAGAAAT pLKO.1 2985 CDS 100% 13.200 9.240 N USP25 n/a
7 TRCN0000318647 GCTGTAGAAGATATGAGAAAT pLKO_005 2985 CDS 100% 13.200 9.240 N USP25 n/a
8 TRCN0000004368 GCTGTTCCTCATCTGTGCTTA pLKO.1 2735 CDS 100% 4.950 3.465 N USP25 n/a
9 TRCN0000349572 GCTGTTCCTCATCTGTGCTTA pLKO_005 2735 CDS 100% 4.950 3.465 N USP25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03088 pDONR223 100% 70.3% 68.6% None 0_1ins715;65_66ins77;1545_1754del n/a
2 ccsbBroad304_03088 pLX_304 0% 70.3% 68.6% V5 0_1ins715;65_66ins77;1545_1754del n/a
3 TRCN0000467162 GTTAGACCGGTCGCTGGTCCGGGT pLX_317 14.4% 70.3% 68.6% V5 0_1ins715;65_66ins77;1545_1754del n/a
4 ccsbBroadEn_11902 pDONR223 100% 40.8% 26.5% None (many diffs) n/a
5 ccsbBroad304_11902 pLX_304 0% 40.8% 26.5% V5 (many diffs) n/a
Download CSV