Transcript: Human XM_024452105.1

PREDICTED: Homo sapiens poly(rC) binding protein 3 (PCBP3), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCBP3 (54039)
Length:
1390
CDS:
75..1343

Additional Resources:

NCBI RefSeq record:
XM_024452105.1
NBCI Gene record:
PCBP3 (54039)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425115 CTTTACACTCCTCCGAAGAAG pLKO_005 1262 CDS 100% 4.950 6.930 N PCBP3 n/a
2 TRCN0000439892 GCACTCATGAGCTCACCATTC pLKO_005 1334 CDS 100% 6.000 4.200 N PCBP3 n/a
3 TRCN0000074699 GCATACAAGTTTGAGGAGGAT pLKO.1 621 CDS 100% 2.640 1.848 N PCBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12028 pDONR223 100% 47.7% 42.7% None (many diffs) n/a
2 ccsbBroad304_12028 pLX_304 0% 47.7% 42.7% V5 (many diffs) n/a
3 TRCN0000469904 ATGCCGTTAATTACTGGTAATACC pLX_317 37.5% 47.7% 42.7% V5 (many diffs) n/a
4 ccsbBroadEn_12029 pDONR223 100% 47.7% 42.7% None (many diffs) n/a
5 ccsbBroad304_12029 pLX_304 0% 47.7% 42.7% V5 (many diffs) n/a
6 TRCN0000479702 AGCGCCTTGAATTGTTTCTCACCC pLX_317 31.8% 47.7% 42.7% V5 (many diffs) n/a
Download CSV