Transcript: Human XM_024452233.1

PREDICTED: Homo sapiens haloacid dehalogenase like hydrolase domain containing 5 (HDHD5), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDHD5 (27440)
Length:
2609
CDS:
1410..2114

Additional Resources:

NCBI RefSeq record:
XM_024452233.1
NBCI Gene record:
HDHD5 (27440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050203 GATAACCCTATGTCTGACGTA pLKO.1 1779 CDS 100% 2.640 3.696 N HDHD5 n/a
2 TRCN0000333644 GATAACCCTATGTCTGACGTA pLKO_005 1779 CDS 100% 2.640 3.696 N HDHD5 n/a
3 TRCN0000050207 CGAGACTTATGCTTCAGTCCA pLKO.1 2007 CDS 100% 2.640 2.112 N HDHD5 n/a
4 TRCN0000353150 CTGTGCCTGGAAACCATTTAC pLKO_005 1611 CDS 100% 13.200 9.240 N HDHD5 n/a
5 TRCN0000353151 ACGTGGTGAATGACGTGAATG pLKO_005 2047 CDS 100% 10.800 7.560 N HDHD5 n/a
6 TRCN0000344867 TTTCCCTGCTGGGTAGCATTT pLKO_005 2284 3UTR 100% 10.800 7.560 N HDHD5 n/a
7 TRCN0000050204 AGGTGGATGCAGACCAAGTTA pLKO.1 355 5UTR 100% 5.625 3.938 N HDHD5 n/a
8 TRCN0000333643 AGGTGGATGCAGACCAAGTTA pLKO_005 355 5UTR 100% 5.625 3.938 N HDHD5 n/a
9 TRCN0000050205 CAAACCCAGCATCCTCACTTA pLKO.1 1676 CDS 100% 4.950 3.465 N HDHD5 n/a
10 TRCN0000050206 TGTTACAAATGCTGGGAACAT pLKO.1 287 5UTR 100% 4.950 3.465 N HDHD5 n/a
11 TRCN0000204533 CCTCCCAAAGTGCTGGAATTA pLKO.1 667 5UTR 100% 13.200 6.600 Y LRRC74B n/a
12 TRCN0000164834 CAAACTCCTGAGCTCAAGCAA pLKO.1 632 5UTR 100% 3.000 1.500 Y LINC00336 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.