Transcript: Human XM_024452334.1

PREDICTED: Homo sapiens PWWP domain containing 3B (PWWP3B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PWWP3B (139221)
Length:
4109
CDS:
581..2671

Additional Resources:

NCBI RefSeq record:
XM_024452334.1
NBCI Gene record:
PWWP3B (139221)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416357 ACAAAGCCAGGGAGGATTATA pLKO_005 1947 CDS 100% 15.000 10.500 N PWWP3B n/a
2 TRCN0000134637 GTCACCTTTGTCATCAGATAT pLKO.1 1300 CDS 100% 13.200 9.240 N PWWP3B n/a
3 TRCN0000136448 CAGTTGGATGAAGTGGTGAAA pLKO.1 2393 CDS 100% 4.950 3.465 N PWWP3B n/a
4 TRCN0000137885 CGAAGAACTTCCACGCTTCAT pLKO.1 1705 CDS 100% 4.950 3.465 N PWWP3B n/a
5 TRCN0000135610 GAGATCACTATGCTGTCTCAA pLKO.1 917 CDS 100% 4.950 3.465 N PWWP3B n/a
6 TRCN0000137771 GAGAACCATCTTCTGGCCATT pLKO.1 2279 CDS 100% 4.050 2.835 N PWWP3B n/a
7 TRCN0000134032 CCAGAATCTGAGAATTTGGAA pLKO.1 3756 3UTR 100% 3.000 2.100 N PWWP3B n/a
8 TRCN0000135127 CACATCCGTTTGAAACAGGAA pLKO.1 1740 CDS 100% 2.640 1.848 N PWWP3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04925 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04925 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473071 CCAATAACCCCTAGGACCACCTCT pLX_317 18.5% 100% 100% V5 n/a
4 ccsbBroadEn_13198 pDONR223 100% 60.9% 58.6% None 1212_1213insT;1275_2088del n/a
Download CSV