Transcript: Human XM_024452370.1

PREDICTED: Homo sapiens LHFPL tetraspan subfamily member 1 (LHFPL1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHFPL1 (340596)
Length:
1290
CDS:
475..1068

Additional Resources:

NCBI RefSeq record:
XM_024452370.1
NBCI Gene record:
LHFPL1 (340596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141952 GATGGAATAGCCCGGAGATAA pLKO.1 965 CDS 100% 13.200 18.480 N LHFPL1 n/a
2 TRCN0000142442 GCCCGGAGATAATGCAAACAT pLKO.1 974 CDS 100% 5.625 3.938 N LHFPL1 n/a
3 TRCN0000142134 GCCAGTGTCATTCAGCACATT pLKO.1 663 CDS 100% 4.950 3.465 N LHFPL1 n/a
4 TRCN0000141608 CTTCCTACCTTACTGGCTCTT pLKO.1 624 CDS 100% 4.050 2.835 N LHFPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13602 pDONR223 100% 71.2% 63.1% None (many diffs) n/a
2 ccsbBroad304_13602 pLX_304 0% 71.2% 63.1% V5 (many diffs) n/a
3 TRCN0000474507 TACTAACTTACGCTAGCGGCTCCT pLX_317 95.2% 71.2% 63.1% V5 (many diffs) n/a
4 ccsbBroadEn_05477 pDONR223 100% 67.2% 65.2% None (many diffs) n/a
5 ccsbBroad304_05477 pLX_304 0% 67.2% 65.2% V5 (many diffs) n/a
6 TRCN0000480663 GATCCGAGCACACTCAAGCAAAAA pLX_317 55% 67.2% 65.2% V5 (many diffs) n/a
Download CSV