Transcript: Human XM_024452429.1

PREDICTED: Homo sapiens TATA-box binding protein associated factor 1 (TAF1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAF1 (6872)
Length:
7715
CDS:
354..5756

Additional Resources:

NCBI RefSeq record:
XM_024452429.1
NBCI Gene record:
TAF1 (6872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006285 CCTTCTAGCATGACTAGGAAT pLKO.1 1347 CDS 100% 4.950 6.930 N TAF1 n/a
2 TRCN0000199486 GCCTAGGTGGTTCACCTTTCC pLKO.1 5799 3UTR 100% 1.350 1.890 N TAF1 n/a
3 TRCN0000280259 GCCTAGGTGGTTCACCTTTCC pLKO_005 5799 3UTR 100% 1.350 1.890 N TAF1 n/a
4 TRCN0000195260 CAATGTCACCCTTTGATTTAA pLKO.1 5939 3UTR 100% 15.000 10.500 N TAF1 n/a
5 TRCN0000280258 CAATGTCACCCTTTGATTTAA pLKO_005 5939 3UTR 100% 15.000 10.500 N TAF1 n/a
6 TRCN0000006288 GCCACTCTTGATGATGACAAA pLKO.1 1401 CDS 100% 4.950 3.465 N TAF1 n/a
7 TRCN0000280260 GCCACTCTTGATGATGACAAA pLKO_005 1401 CDS 100% 4.950 3.465 N TAF1 n/a
8 TRCN0000006286 GCTGCAAGCATTTGAGAACAA pLKO.1 2252 CDS 100% 4.950 3.465 N TAF1 n/a
9 TRCN0000006284 GTACAGTATCTGATCCTGAAA pLKO.1 5837 3UTR 100% 4.950 3.465 N TAF1 n/a
10 TRCN0000297802 GTACAGTATCTGATCCTGAAA pLKO_005 5837 3UTR 100% 4.950 3.465 N TAF1 n/a
11 TRCN0000195160 CCACTGTTCACTGTGACTATT pLKO.1 4114 CDS 100% 13.200 7.920 N TAF1 n/a
12 TRCN0000280315 CCACTGTTCACTGTGACTATT pLKO_005 4114 CDS 100% 13.200 7.920 N TAF1 n/a
13 TRCN0000006287 CCAATGGATTTAGAGACCATA pLKO.1 4674 CDS 100% 4.950 2.970 N TAF1 n/a
14 TRCN0000196898 GCAAAGATGGTGATCTTATTC pLKO.1 2053 CDS 100% 1.320 0.792 N TAF1 n/a
15 TRCN0000196851 GCCAACAGTGTTAAGTATAAT pLKO.1 4764 CDS 100% 15.000 7.500 Y TAF1L n/a
16 TRCN0000349745 GCCAACAGTGTTAAGTATAAT pLKO_005 4764 CDS 100% 15.000 7.500 Y TAF1L n/a
17 TRCN0000195039 CCAAGCAACTTCTACGTAAAT pLKO.1 3043 CDS 100% 13.200 6.600 Y TAF1L n/a
18 TRCN0000196373 GTTACTATATTCGGGAATTAG pLKO.1 2344 CDS 100% 13.200 6.600 Y TAF1L n/a
19 TRCN0000312663 GTTACTATATTCGGGAATTAG pLKO_005 2344 CDS 100% 13.200 6.600 Y TAF1L n/a
20 TRCN0000079049 GCTGGGATTATGCAGCATGAT pLKO.1 669 CDS 100% 4.950 2.475 Y Taf1 n/a
21 TRCN0000037502 CCAGCATTCAATTCCTGCTAT pLKO.1 1802 CDS 100% 4.950 2.475 Y TAF1L n/a
22 TRCN0000092942 GAAGATGAGGAGGAGGAAGAA pLKO.1 5625 CDS 100% 4.950 2.475 Y Gm13232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.