Transcript: Human XM_024452738.1

PREDICTED: Homo sapiens UBX domain protein 2A (UBXN2A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBXN2A (165324)
Length:
2232
CDS:
497..1099

Additional Resources:

NCBI RefSeq record:
XM_024452738.1
NBCI Gene record:
UBXN2A (165324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414043 ATTCACCGTCAACGACGATTT pLKO_005 532 CDS 100% 10.800 15.120 N UBXN2A n/a
2 TRCN0000007810 CCCAGACAGCAGGGATTTATT pLKO.1 1436 3UTR 100% 15.000 10.500 N UBXN2A n/a
3 TRCN0000423788 TAAAGAAGAGGTGGACGTTAA pLKO_005 640 CDS 100% 10.800 7.560 N UBXN2A n/a
4 TRCN0000007813 CTGAACAACTTGGAACCCATT pLKO.1 818 CDS 100% 4.050 2.835 N UBXN2A n/a
5 TRCN0000007814 GTCATCATTCAGAGACTCCAA pLKO.1 1043 CDS 100% 2.640 1.848 N UBXN2A n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1834 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05134 pDONR223 100% 76.9% 76.8% None 0_1ins178;2delT n/a
2 ccsbBroad304_05134 pLX_304 0% 76.9% 76.8% V5 0_1ins178;2delT n/a
3 TRCN0000477066 CCCCCTGAGCGTAGACCATACTCA pLX_317 51.7% 76.9% 76.8% V5 0_1ins178;2delT n/a
Download CSV