Transcript: Human XM_024452791.1

PREDICTED: Homo sapiens vacuolar protein sorting 45 homolog (VPS45), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS45 (11311)
Length:
2399
CDS:
344..1948

Additional Resources:

NCBI RefSeq record:
XM_024452791.1
NBCI Gene record:
VPS45 (11311)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365272 GTTAAGCAAGTGATAACTAAA pLKO_005 806 CDS 100% 13.200 18.480 N VPS45 n/a
2 TRCN0000376630 CCACGAACTACTAGGCATAAA pLKO_005 943 CDS 100% 13.200 9.240 N VPS45 n/a
3 TRCN0000370341 CCCAGAGTTGTCCTAACAATA pLKO_005 2108 3UTR 100% 13.200 9.240 N VPS45 n/a
4 TRCN0000365212 GTTGCTGCCAGGGTCGAAATT pLKO_005 663 CDS 100% 13.200 9.240 N VPS45 n/a
5 TRCN0000370340 GGCATAGTGAGTATGGTATAC pLKO_005 332 5UTR 100% 10.800 7.560 N VPS45 n/a
6 TRCN0000156836 GATCAGCAAGAGTGACGTGAA pLKO.1 538 CDS 100% 4.050 2.835 N VPS45 n/a
7 TRCN0000370396 CTAGTGCTCTCCAGAATATAA pLKO_005 1326 CDS 100% 0.000 0.000 N VPS45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02669 pDONR223 100% 93.6% 93.6% None 0_1ins108 n/a
2 ccsbBroad304_02669 pLX_304 0% 93.6% 93.6% V5 0_1ins108 n/a
3 TRCN0000470892 GGTATCGAACGTACGTCATTGACT pLX_317 28.4% 93.6% 93.6% V5 0_1ins108 n/a
Download CSV