Transcript: Human XM_024452988.1

PREDICTED: Homo sapiens methyl-CpG binding domain protein 5 (MBD5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MBD5 (55777)
Length:
5536
CDS:
313..5454

Additional Resources:

NCBI RefSeq record:
XM_024452988.1
NBCI Gene record:
MBD5 (55777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253599 GGATATCCCTAACCCATTAAT pLKO_005 1869 CDS 100% 15.000 12.000 N Mbd5 n/a
2 TRCN0000295991 GGATATCCCTAACCCATTAAT pLKO_005 1869 CDS 100% 15.000 12.000 N MBD5 n/a
3 TRCN0000038771 CCCAAAGATCACGCTCATCTT pLKO.1 1682 CDS 100% 0.495 0.396 N MBD5 n/a
4 TRCN0000298783 CCCAAAGATCACGCTCATCTT pLKO_005 1682 CDS 100% 0.495 0.396 N MBD5 n/a
5 TRCN0000253598 CCTAAACCAGAATCTATTAAA pLKO_005 3111 CDS 100% 15.000 10.500 N Mbd5 n/a
6 TRCN0000295983 GGCCACTTCTAGTGGTATTAA pLKO_005 1752 CDS 100% 15.000 10.500 N MBD5 n/a
7 TRCN0000295940 TCATCAGGTTCCCAGATATAT pLKO_005 988 CDS 100% 15.000 10.500 N MBD5 n/a
8 TRCN0000038773 GCTTGTCTGTTTCAGAACTTT pLKO.1 4042 CDS 100% 5.625 3.938 N MBD5 n/a
9 TRCN0000038769 CGAGCAATGTTCCACCACAAA pLKO.1 1285 CDS 100% 4.950 3.465 N MBD5 n/a
10 TRCN0000038772 GCCAAATCAAAGGACTGACTT pLKO.1 5183 CDS 100% 4.950 3.465 N MBD5 n/a
11 TRCN0000038770 GCTGTTAAACAACAATCAGAT pLKO.1 3915 CDS 100% 4.950 3.465 N MBD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12272 pDONR223 100% 13% 12.8% None (many diffs) n/a
2 ccsbBroad304_12272 pLX_304 0% 13% 12.8% V5 (many diffs) n/a
3 TRCN0000473566 CCTTGGAACCGATTTTTTGTAAAG pLX_317 67% 13% 12.8% V5 (many diffs) n/a
Download CSV