Transcript: Human XM_024453026.1

PREDICTED: Homo sapiens ankyrin repeat domain 36B (ANKRD36B), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD36B (57730)
Length:
4177
CDS:
808..4173

Additional Resources:

NCBI RefSeq record:
XM_024453026.1
NBCI Gene record:
ANKRD36B (57730)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365720 TCGCGTCACTGCACCTATTTA pLKO_005 3913 CDS 100% 15.000 7.500 Y ANKRD36 n/a
2 TRCN0000365723 CACGTGCAAAGTGAGCTAAAG pLKO_005 3475 CDS 100% 10.800 5.400 Y ANKRD36 n/a
3 TRCN0000365719 TCGATGTGATCATGATCAAAG pLKO_005 3258 CDS 100% 10.800 5.400 Y ANKRD36 n/a
4 TRCN0000152758 GCTACAAGTGACGACAAAGAT pLKO.1 904 CDS 100% 5.625 2.813 Y ANKRD36C n/a
5 TRCN0000154273 GCTACAAGTGACGAGAAAGAT pLKO.1 1006 CDS 100% 5.625 2.813 Y ANKRD36C n/a
6 TRCN0000167206 CAAGAAATACAGGATCAACTT pLKO.1 3988 CDS 100% 4.950 2.475 Y ANKRD36B n/a
7 TRCN0000153451 CACTGTGAGCAACTTAGAGTA pLKO.1 2590 CDS 100% 4.950 2.475 Y ANKRD36C n/a
8 TRCN0000167527 GAGAAAGCAGAAAGAGAAGTA pLKO.1 3814 CDS 100% 4.950 2.475 Y ANKRD36B n/a
9 TRCN0000365722 TACCTTCTGCTCACGTATTAT pLKO_005 291 5UTR 100% 0.000 0.000 Y ANKRD36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10271 pDONR223 100% 9.6% 7.2% None (many diffs) n/a
2 ccsbBroad304_10271 pLX_304 0% 9.6% 7.2% V5 (many diffs) n/a
3 TRCN0000478647 CGCTGAAAACACGAATTGAACTCC pLX_317 89.1% 9.6% 7.2% V5 (many diffs) n/a
Download CSV