Transcript: Human XM_024453161.1

PREDICTED: Homo sapiens testis specific 10 (TSGA10), transcript variant X27, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSGA10 (80705)
Length:
3956
CDS:
924..3020

Additional Resources:

NCBI RefSeq record:
XM_024453161.1
NBCI Gene record:
TSGA10 (80705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150340 GCAGATAACAATACCCTCAAA pLKO.1 2229 CDS 100% 4.950 6.930 N TSGA10 n/a
2 TRCN0000153642 CCACAGAACGAGATAGTCTAA pLKO.1 1270 CDS 100% 4.950 3.960 N TSGA10 n/a
3 TRCN0000152224 CAGTGATCTGAGATGACTTAT pLKO.1 3180 3UTR 100% 13.200 9.240 N TSGA10 n/a
4 TRCN0000151113 GCCAATCGAGACAAAGAATAT pLKO.1 2640 CDS 100% 13.200 9.240 N TSGA10 n/a
5 TRCN0000150901 GCTGTAAGAGTCCTAAATCAA pLKO.1 1177 CDS 100% 5.625 3.938 N TSGA10 n/a
6 TRCN0000150866 GAGAATCTTTGCTACAGAGAT pLKO.1 2994 CDS 100% 4.950 3.465 N TSGA10 n/a
7 TRCN0000156661 GAGGCCCTAATTGTGTGTGAA pLKO.1 1872 CDS 100% 4.950 3.465 N TSGA10 n/a
8 TRCN0000152670 GCAGTGATCTGAGATGACTTA pLKO.1 3179 3UTR 100% 4.950 3.465 N TSGA10 n/a
9 TRCN0000157894 CCTTGGAGAGAGTTTGGCAAT pLKO.1 1781 CDS 100% 4.050 2.835 N TSGA10 n/a
10 TRCN0000151555 GTCTCTGAATCTCTGTTCTAA pLKO.1 3147 3UTR 100% 5.625 3.375 N TSGA10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14285 pDONR223 100% 99.9% 28.3% None 587delA;817C>A n/a
2 ccsbBroad304_14285 pLX_304 0% 99.9% 28.3% V5 (not translated due to prior stop codon) 587delA;817C>A n/a
3 TRCN0000473689 CCATCAGATCATGACCTAGCGTTC pLX_317 19.9% 99.9% 28.3% V5 (not translated due to prior stop codon) 587delA;817C>A n/a
Download CSV