Transcript: Human XM_024453354.1

PREDICTED: Homo sapiens leucine rich single-pass membrane protein 2 (LSMEM2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LSMEM2 (132228)
Length:
932
CDS:
412..834

Additional Resources:

NCBI RefSeq record:
XM_024453354.1
NBCI Gene record:
LSMEM2 (132228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165221 GACACTACTCAAACTCCGCTT pLKO.1 756 CDS 100% 2.160 3.024 N LSMEM2 n/a
2 TRCN0000166234 CAGGAGGAGACACTACTCAAA pLKO.1 748 CDS 100% 4.950 3.465 N LSMEM2 n/a
3 TRCN0000164908 GAGGAGACACTACTCAAACTC pLKO.1 751 CDS 100% 4.950 3.465 N LSMEM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04880 pDONR223 100% 85.3% 85.3% None 0_1ins72 n/a
2 ccsbBroad304_04880 pLX_304 0% 85.3% 85.3% V5 0_1ins72 n/a
3 TRCN0000478319 CCTGGCCTTGTAGCACGTATTTCC pLX_317 66.9% 85.3% 85.3% V5 0_1ins72 n/a
Download CSV