Transcript: Human XM_024453364.1

PREDICTED: Homo sapiens coiled-coil domain containing 12 (CCDC12), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC12 (151903)
Length:
1397
CDS:
531..1070

Additional Resources:

NCBI RefSeq record:
XM_024453364.1
NBCI Gene record:
CCDC12 (151903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376552 TGATCCGTGAAAGGCTGAAAG pLKO_005 982 CDS 100% 10.800 15.120 N CCDC12 n/a
2 TRCN0000074975 CTGATCCGTGAAAGGCTGAAA pLKO.1 981 CDS 100% 4.950 6.930 N CCDC12 n/a
3 TRCN0000365045 GAACTATGTCCCGGAGGATGA pLKO_005 749 CDS 100% 4.050 5.670 N CCDC12 n/a
4 TRCN0000377500 ACCGGTTGCAGTGGAGGAGAA pLKO_005 803 CDS 100% 1.350 1.890 N CCDC12 n/a
5 TRCN0000376553 CGAGAAGCACAGGGAACTTAG pLKO_005 722 CDS 100% 10.800 8.640 N CCDC12 n/a
6 TRCN0000074974 CGGAACTATGTCCCGGAGGAT pLKO.1 747 CDS 100% 0.880 0.704 N CCDC12 n/a
7 TRCN0000370099 GCTTGCCATCACCTCCAGTTT pLKO_005 1145 3UTR 100% 4.950 3.465 N CCDC12 n/a
8 TRCN0000377453 GGAGCCAAAGACCAAGCATCT pLKO_005 680 CDS 100% 4.050 2.835 N CCDC12 n/a
9 TRCN0000074977 CAGGGAACTTAGGCTGCGGAA pLKO.1 731 CDS 100% 0.720 0.504 N CCDC12 n/a
10 TRCN0000074973 CCATTCTGAATGGAGGCAGAA pLKO.1 1249 3UTR 100% 0.405 0.284 N CCDC12 n/a
11 TRCN0000376551 CCTGCCCATCAAGTCTGAAAC pLKO_005 1185 3UTR 100% 10.800 6.480 N CCDC12 n/a
12 TRCN0000074976 GCCAAGAAGCTGGAGAAACTA pLKO.1 930 CDS 100% 5.625 3.375 N CCDC12 n/a
13 TRCN0000376554 TGGATGCTGCCACCGAACAAA pLKO_005 1030 CDS 100% 5.625 3.375 N CCDC12 n/a
14 TRCN0000377451 TGACTGGGACCTCAAGAGAGA pLKO_005 905 CDS 100% 2.640 1.584 N CCDC12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13281 pDONR223 100% 92.3% 92.7% None 1_39del;48A>G;441C>T n/a
2 ccsbBroad304_13281 pLX_304 0% 92.3% 92.7% V5 1_39del;48A>G;441C>T n/a
3 TRCN0000475515 TTGAAGCACTGCCTCCCTGGTCAG pLX_317 73.1% 92.3% 92.7% V5 1_39del;48A>G;441C>T n/a
Download CSV