Transcript: Human XM_024453377.1

PREDICTED: Homo sapiens immunoglobulin superfamily member 11 (IGSF11), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IGSF11 (152404)
Length:
1279
CDS:
92..1147

Additional Resources:

NCBI RefSeq record:
XM_024453377.1
NBCI Gene record:
IGSF11 (152404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431895 TGGCACTGGTGCAGTTATTAT pLKO_005 982 CDS 100% 15.000 21.000 N IGSF11 n/a
2 TRCN0000137264 GCCCAGGAACATTGGACTAAT pLKO.1 949 CDS 100% 13.200 9.240 N IGSF11 n/a
3 TRCN0000137274 CAGGGTGGACAGATGTTTGAT pLKO.1 470 CDS 100% 5.625 3.938 N IGSF11 n/a
4 TRCN0000137089 CCTGAACAGGTCATCCTGTAT pLKO.1 449 CDS 100% 0.495 0.347 N IGSF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09684 pDONR223 100% 57.4% 54.7% None (many diffs) n/a
2 ccsbBroad304_09684 pLX_304 0% 57.4% 54.7% V5 (many diffs) n/a
3 TRCN0000480176 TTCCTACGGGACCTCAATCGAACG pLX_317 25.9% 57.4% 54.7% V5 (many diffs) n/a
Download CSV