Construct: ORF TRCN0000480176
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014392.2_s317c1
- Derived from:
- ccsbBroadEn_09684
- DNA Barcode:
- TTCCTACGGGACCTCAATCGAACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IGSF11 (152404)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480176
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353320.2 | 99.8% | 99.5% | 112C>A;1282T>A |
2 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_152538.4 | 99.8% | 99.5% | 112C>A;1282T>A |
3 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_011512469.1 | 99.8% | 99.5% | 112C>A;1282T>A |
4 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001015887.3 | 97.4% | 95.8% | (many diffs) |
5 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_024453376.1 | 95% | 93.4% | (many diffs) |
6 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353322.2 | 94.2% | 93.7% | 112C>A;628_629ins72;1210T>A |
7 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353321.2 | 91.9% | 90.1% | (many diffs) |
8 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353323.2 | 91% | 89.1% | (many diffs) |
9 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_011512463.1 | 89.4% | 88.9% | 50_199del;262C>A;1432T>A |
10 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_011512464.2 | 89.4% | 88.9% | 50_199del;262C>A;1432T>A |
11 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_011512465.2 | 89.4% | 88.9% | 50_199del;262C>A;1432T>A |
12 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353318.2 | 87.5% | 86% | (many diffs) |
13 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353325.2 | 86.4% | 86.2% | 0_1ins174;1108T>A |
14 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_017005789.1 | 86.4% | 86.2% | 0_1ins174;1108T>A |
15 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353324.2 | 85.5% | 83.9% | (many diffs) |
16 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_011512466.2 | 82.5% | 80.8% | (many diffs) |
17 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353319.2 | 81.7% | 80% | (many diffs) |
18 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | NM_001353326.2 | 80.8% | 80.4% | 0_1ins174;454_455ins72;1036T>A |
19 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_011512471.3 | 76.8% | 75.2% | (many diffs) |
20 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_024453377.1 | 57.4% | 54.7% | (many diffs) |
21 | human | 152404 | IGSF11 | immunoglobulin superfamily ... | XM_011512474.3 | 51.7% | 48.8% | (many diffs) |
22 | mouse | 207683 | Igsf11 | immunoglobulin superfamily,... | NM_170599.2 | 84.9% | 85.4% | (many diffs) |
23 | mouse | 207683 | Igsf11 | immunoglobulin superfamily,... | XM_006521892.2 | 83.8% | 86.4% | (many diffs) |
24 | mouse | 207683 | Igsf11 | immunoglobulin superfamily,... | XM_006521893.2 | 83.6% | 86.5% | (many diffs) |
25 | mouse | 207683 | Igsf11 | immunoglobulin superfamily,... | XM_011245851.1 | 74.4% | 77.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1356
- ORF length:
- 1290
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tctggtggaa cttttgctct ggtggaactg cttttctaga actggtgttg 121 cagcatccct ggaagtgtca gagagccctg ggagtatcca ggtggcccgg ggtcagacag 181 cagtcctgcc ctgcactttc actaccagcg ctgccctcat taacctcaat gtcatttgga 241 tggtcactcc tctctccaat gccaaccaac ctgaacaggt catcctgtat cagggtggac 301 agatgtttga tggtgccccc cggttccacg gtagggtagg atttacaggc accatgccag 361 ctaccaatgt ctctatcttc attaataaca ctcagttatc agacactggc acctaccagt 421 gcctggtcaa caaccttcca gacatagggg gcaggaacat tggggtcacc ggtctcacag 481 tgttagttcc cccttctgcc ccacactgcc aaatccaagg atcccaggat attggcagcg 541 atgtcatcct gctctgtagc tcagaggaag gcattcctcg accaacttac ctttgggaga 601 agttagacaa taccctcaaa ctacctccaa cagctactca ggaccaggtc cagggaacag 661 tcaccatccg gaacatcagt gccctgtctt caggtttgta ccagtgcgtg gcttctaatg 721 ctattggaac cagcacctgt cttctggatc tccaggttat ttcaccccag cccaggaaca 781 ttggactaat agctggagcc attggcactg gtgcagttat tatcattttt tgcattgcac 841 taattttagg ggcattcttt tactggagaa gcaaaaataa agaggaggaa gaagaagaaa 901 ttcctaatga aataagagag gatgatcttc cacccaagtg ttcttctgcc aaagcatttc 961 acactgagat ttcctcctcg gacaacaaca cactaacctc ttccaatgcc tacaacagtc 1021 gatactGGAG CAACAATCCA AAAGTTCATA GAAACACAGA GTCAGTCAGC CACTTCAGTG 1081 ACTTGGGCCA ATCTTTCTCT TTCCACTCAG GCAATGCCAA CATACCATCC ATTTATGCTA 1141 ATGGGACCCA TCTGGTCCCG GGTCAACATA AGACTCTGGT AGTGACAGCC AACAGAGGGT 1201 CATCACCACA GGTGATGTCC AGGAGCAATG GCTCAGTCAG TAGGAAGCCT CGGCCTCCAC 1261 ACACTCATTC CTACACCATC AGCCACGCAA CACTGGAACG AATTGGTGCA GTACCTGTCA 1321 TGGTACCAGC CCAGAGTCGG GCCGGGACCT TGGTATACCC AACTTTCTTG TACAAAGTGG 1381 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1441 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1501 ATTCCTACGG GACCTCAATC GAACGACGCG TTAAGTCgac aatcaacctc tggattacaa 1561 aatttgtgaa agatt