Transcript: Human XM_024453490.1

PREDICTED: Homo sapiens glutamate metabotropic receptor 2 (GRM2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRM2 (2912)
Length:
4503
CDS:
1911..3218

Additional Resources:

NCBI RefSeq record:
XM_024453490.1
NBCI Gene record:
GRM2 (2912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009013 CACTGCCATCACTGGTGTTAT pLKO.1 2309 CDS 100% 13.200 10.560 N GRM2 n/a
2 TRCN0000378254 ACCGCTTTGGTGATGGTATTG pLKO_005 4339 3UTR 100% 10.800 8.640 N GRM2 n/a
3 TRCN0000378324 TTGTGCTCAACGTCAAGTTTG pLKO_005 3175 CDS 100% 10.800 8.640 N GRM2 n/a
4 TRCN0000011671 CCCTTGGAACAACAGCCGGAA pLKO.1 2915 CDS 100% 0.720 0.504 N GRM2 n/a
5 TRCN0000378328 AGATCATGTTTGTGGTCAATG pLKO_005 3040 CDS 100% 10.800 6.480 N GRM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489033 AAACGATTACCACGTACTCTGTGC pLX_317 14.8% 49.3% 49.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488215 GGACTACGACGTGACCTAGTCAAG pLX_317 12.2% 49.3% 49.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488984 GCTCTGCAATATGTCCCCTAACAA pLX_317 12.1% 49.3% 49.1% V5 (many diffs) n/a
Download CSV