Transcript: Human XM_024453610.1

PREDICTED: Homo sapiens solute carrier family 41 member 3 (SLC41A3), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC41A3 (54946)
Length:
1582
CDS:
117..1532

Additional Resources:

NCBI RefSeq record:
XM_024453610.1
NBCI Gene record:
SLC41A3 (54946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044669 CACGTCAGAAATCAATTCCAT pLKO.1 1106 CDS 100% 3.000 2.400 N SLC41A3 n/a
2 TRCN0000307215 CACGTCAGAAATCAATTCCAT pLKO_005 1106 CDS 100% 3.000 2.400 N SLC41A3 n/a
3 TRCN0000044672 CGGCATGCTTCTGGACTATTT pLKO.1 365 CDS 100% 13.200 9.240 N SLC41A3 n/a
4 TRCN0000290620 CGGCATGCTTCTGGACTATTT pLKO_005 365 CDS 100% 13.200 9.240 N SLC41A3 n/a
5 TRCN0000044668 GCTGATGGTCTGTATAGTGAT pLKO.1 611 CDS 100% 4.950 3.465 N SLC41A3 n/a
6 TRCN0000290560 GCTGATGGTCTGTATAGTGAT pLKO_005 611 CDS 100% 4.950 3.465 N SLC41A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08433 pDONR223 100% 92.7% 92.7% None 184A>G;273_274ins108;1167C>G n/a
2 ccsbBroad304_08433 pLX_304 0% 92.7% 92.7% V5 184A>G;273_274ins108;1167C>G n/a
3 TRCN0000465651 CTCAGCCCGCGGGGGATATCACAT pLX_317 24.9% 92.7% 92.7% V5 184A>G;273_274ins108;1167C>G n/a
4 ccsbBroadEn_15877 pDONR223 0% 91.3% 91.3% None (many diffs) n/a
5 ccsbBroad304_15877 pLX_304 0% 91.3% 91.3% V5 (many diffs) n/a
6 TRCN0000466372 CGACGTAGGTTATGCAGATCAGCA pLX_317 23.9% 91.3% 91.3% V5 (many diffs) n/a
7 ccsbBroadEn_12118 pDONR223 100% 86.2% 81.5% None (many diffs) n/a
8 ccsbBroad304_12118 pLX_304 0% 86.2% 81.5% V5 (many diffs) n/a
9 TRCN0000480826 GTCACCAGGCGATCCCGACCAAGC pLX_317 23% 86.2% 81.5% V5 (many diffs) n/a
Download CSV