Transcript: Human XM_024453671.1

PREDICTED: Homo sapiens phospholipid scramblase 2 (PLSCR2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLSCR2 (57047)
Length:
2913
CDS:
459..1352

Additional Resources:

NCBI RefSeq record:
XM_024453671.1
NBCI Gene record:
PLSCR2 (57047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053353 CGCCAGGATTGGAATACTTAA pLKO.1 709 CDS 100% 13.200 10.560 N PLSCR2 n/a
2 TRCN0000053356 CTTTGGGCAGAGGATTTATTT pLKO.1 824 CDS 100% 15.000 10.500 N PLSCR2 n/a
3 TRCN0000412727 TTGAAAGTAGTAACATGTATG pLKO_005 790 CDS 100% 10.800 7.560 N PLSCR2 n/a
4 TRCN0000053354 GACCACTAAGATGTAACTGTT pLKO.1 952 CDS 100% 4.950 3.465 N PLSCR2 n/a
5 TRCN0000429723 GGATTAATGATTCCGGATCTT pLKO_005 1379 3UTR 100% 4.950 3.465 N PLSCR2 n/a
6 TRCN0000053357 ACTGATAATGTGGGTCGAGAA pLKO.1 915 CDS 100% 4.050 2.835 N PLSCR2 n/a
7 TRCN0000053355 GCAGGATTTCTAAGCACTGGT pLKO.1 1192 CDS 100% 2.640 1.848 N PLSCR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06741 pDONR223 100% 73.3% 66.4% None (many diffs) n/a
2 ccsbBroad304_06741 pLX_304 0% 73.3% 66.4% V5 (many diffs) n/a
3 TRCN0000468286 TGATGCTGGTGCTTGCACTTAGCC pLX_317 39% 73.3% 66.4% V5 (many diffs) n/a
Download CSV