Transcript: Human XM_024453716.1

PREDICTED: Homo sapiens fibronectin type III domain containing 3B (FNDC3B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FNDC3B (64778)
Length:
11122
CDS:
4286..7900

Additional Resources:

NCBI RefSeq record:
XM_024453716.1
NBCI Gene record:
FNDC3B (64778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229813 CGGTAGTGGTCCCGGAATTAA pLKO_005 4999 CDS 100% 15.000 21.000 N FNDC3B n/a
2 TRCN0000082777 GCCATCATTGTGCTTGGCTTT pLKO.1 7826 CDS 100% 4.050 5.670 N FNDC3B n/a
3 TRCN0000082773 CCCTAATTGAATGTGTTTGAA pLKO.1 10831 3UTR 100% 5.625 4.500 N FNDC3B n/a
4 TRCN0000082776 GCAGCCCAAAGTCGAATGATT pLKO.1 5043 CDS 100% 5.625 4.500 N FNDC3B n/a
5 TRCN0000082774 CGGATCTGAAATCCTTGCTTA pLKO.1 6973 CDS 100% 4.950 3.960 N FNDC3B n/a
6 TRCN0000082775 CGTGCAATAACGGATCTGAAA pLKO.1 6963 CDS 100% 4.950 3.960 N FNDC3B n/a
7 TRCN0000229811 ATGCAGCTCAGCAGGTTATTC pLKO_005 4383 CDS 100% 13.200 9.240 N FNDC3B n/a
8 TRCN0000229812 CATGTGCCTCCAGGTTATATC pLKO_005 4523 CDS 100% 13.200 9.240 N FNDC3B n/a
9 TRCN0000229814 GGACAGAAACAAGAGGTTTAT pLKO_005 7279 CDS 100% 13.200 9.240 N FNDC3B n/a
10 TRCN0000218262 GTGTTACTCTTACGTGTTTAT pLKO_005 9257 3UTR 100% 13.200 9.240 N FNDC3B n/a
11 TRCN0000382174 TGCCATGTACAATTCCGTAAA pLKO_005 5353 CDS 100% 10.800 7.560 N FNDC3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12489 pDONR223 100% 5.2% 4.9% None (many diffs) n/a
2 ccsbBroad304_12489 pLX_304 0% 5.2% 4.9% V5 (many diffs) n/a
3 TRCN0000473998 CTTAAATCGATCTACCCCACAGTC pLX_317 100% 5.2% 4.9% V5 (many diffs) n/a
Download CSV