Transcript: Human XM_024453840.1

PREDICTED: Homo sapiens TBC1 domain family member 5 (TBC1D5), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D5 (9779)
Length:
6293
CDS:
515..2494

Additional Resources:

NCBI RefSeq record:
XM_024453840.1
NBCI Gene record:
TBC1D5 (9779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134114 CATGTGCAAATACTGTGCAAA pLKO.1 1918 CDS 100% 4.950 3.465 N TBC1D5 n/a
2 TRCN0000281126 CATGTGCAAATACTGTGCAAA pLKO_005 1918 CDS 100% 4.950 3.465 N TBC1D5 n/a
3 TRCN0000136647 GAGAACGAACAGATCACCATT pLKO.1 2096 CDS 100% 4.950 3.465 N TBC1D5 n/a
4 TRCN0000281125 GAGAACGAACAGATCACCATT pLKO_005 2096 CDS 100% 4.950 3.465 N TBC1D5 n/a
5 TRCN0000138888 GCAAAGGTGATGGACACTCAT pLKO.1 1934 CDS 100% 4.950 3.465 N TBC1D5 n/a
6 TRCN0000281193 GCAAAGGTGATGGACACTCAT pLKO_005 1934 CDS 100% 4.950 3.465 N TBC1D5 n/a
7 TRCN0000138715 GCTCTGAGTTAGAGCTGAGTT pLKO.1 2740 3UTR 100% 0.495 0.347 N TBC1D5 n/a
8 TRCN0000134264 GCTGATGAAATCAGAAAGCAT pLKO.1 1654 CDS 100% 3.000 1.800 N TBC1D5 n/a
9 TRCN0000281194 GCTGATGAAATCAGAAAGCAT pLKO_005 1654 CDS 100% 3.000 1.800 N TBC1D5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02241 pDONR223 100% 82.8% 82.8% None 0_1ins408 n/a
2 ccsbBroad304_02241 pLX_304 0% 82.8% 82.8% V5 0_1ins408 n/a
Download CSV