Transcript: Human XM_024453955.1

PREDICTED: Homo sapiens SEL1L family member 3 (SEL1L3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEL1L3 (23231)
Length:
2480
CDS:
402..2405

Additional Resources:

NCBI RefSeq record:
XM_024453955.1
NBCI Gene record:
SEL1L3 (23231)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161585 GAACGCCCTTTCAAAGATCAT pLKO.1 576 CDS 100% 4.950 6.930 N SEL1L3 n/a
2 TRCN0000187272 CGCCTGGATTACTCACAAATA pLKO.1 464 CDS 100% 13.200 9.240 N SEL1L3 n/a
3 TRCN0000161039 GCTACCACAATCAGACCATTA pLKO.1 1078 CDS 100% 10.800 7.560 N SEL1L3 n/a
4 TRCN0000204183 GCCAGATAGTAGTAACCACTA pLKO.1 1036 CDS 100% 4.050 2.835 N SEL1L3 n/a
5 TRCN0000159090 GCTGAGGTTCAAGAAATAGTA pLKO.1 1296 CDS 100% 5.625 3.375 N SEL1L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11701 pDONR223 100% 68% 68% None 1999G>A;2001_2001delAins937 n/a
2 ccsbBroad304_11701 pLX_304 0% 68% 68% V5 1999G>A;2001_2001delAins937 n/a
3 TRCN0000479888 TTGTCTTGTGTTTTTGCACATTTA pLX_317 13.8% 68% 68% V5 1999G>A;2001_2001delAins937 n/a
Download CSV