Transcript: Human XM_024453958.1

PREDICTED: Homo sapiens transmembrane 131 like (TMEM131L), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM131L (23240)
Length:
4080
CDS:
94..3048

Additional Resources:

NCBI RefSeq record:
XM_024453958.1
NBCI Gene record:
TMEM131L (23240)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416501 GCAATCCCATGACCGTGAATA pLKO_005 2273 CDS 100% 13.200 18.480 N TMEM131L n/a
2 TRCN0000135011 CCCGGTTCATAATAGTTTCAT pLKO.1 2529 CDS 100% 5.625 7.875 N TMEM131L n/a
3 TRCN0000134727 GCAAGAACTTTCTCGATACAT pLKO.1 956 CDS 100% 5.625 7.875 N TMEM131L n/a
4 TRCN0000135183 CCTTTCGTAGAGCAAGAAGAT pLKO.1 1714 CDS 100% 4.950 6.930 N TMEM131L n/a
5 TRCN0000427488 AGGAGGCTCACTCCGATTTAA pLKO_005 369 CDS 100% 15.000 10.500 N TMEM131L n/a
6 TRCN0000436603 TGTAAAGCAGATGCCGAAATT pLKO_005 1963 CDS 100% 13.200 9.240 N TMEM131L n/a
7 TRCN0000136994 CCTGCTGCTAAAGAGGACATT pLKO.1 1201 CDS 100% 4.950 3.465 N TMEM131L n/a
8 TRCN0000167099 CCGGAATAACTTGACTGTTAT pLKO.1 279 CDS 100% 1.320 0.792 N TMEM131L n/a
9 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 3415 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14076 pDONR223 100% 65.1% 65.1% None 0_1ins1488;1052G>A;2270_2326del n/a
2 ccsbBroad304_14076 pLX_304 0% 65.1% 65.1% V5 0_1ins1488;1052G>A;2270_2326del n/a
3 TRCN0000466700 ACACCTAAACCACCATAACCAAAT pLX_317 6.5% 65.1% 65.1% V5 0_1ins1488;1052G>A;2270_2326del n/a
Download CSV