Transcript: Human XM_024454043.1

PREDICTED: Homo sapiens Fc fragment of IgG receptor IIb (FCGR2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FCGR2B (2213)
Length:
1955
CDS:
56..1030

Additional Resources:

NCBI RefSeq record:
XM_024454043.1
NBCI Gene record:
FCGR2B (2213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029580 GATTTCAGCTCTCCCAGGATA pLKO.1 808 CDS 100% 4.950 3.465 N FCGR2B n/a
2 TRCN0000029581 CCACAGTCACAGTGGTGATTA pLKO.1 616 CDS 100% 13.200 6.600 Y FCGR2B n/a
3 TRCN0000029584 GCCTTGATCTACTGCAGGAAA pLKO.1 782 CDS 100% 4.950 2.475 Y FCGR2C n/a
4 TRCN0000029587 CAGTGGTTCCACAATGGGAAT pLKO.1 302 CDS 100% 4.050 2.025 Y FCGR2C n/a
5 TRCN0000029582 CATATGCTTCTGTGGACAGCT pLKO.1 134 CDS 100% 0.000 0.000 Y FCGR2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00546 pDONR223 100% 84.8% 85.6% None (many diffs) n/a
2 ccsbBroad304_00546 pLX_304 0% 84.8% 85.6% V5 (many diffs) n/a
3 TRCN0000471042 AAGTCCACGAAAGCGTGGAATATT pLX_317 42.2% 84.8% 85.6% V5 (many diffs) n/a
4 ccsbBroadEn_06198 pDONR223 100% 71.9% 58.9% None (many diffs) n/a
5 ccsbBroad304_06198 pLX_304 0% 71.9% 58.9% V5 (many diffs) n/a
6 TRCN0000472330 ACTGGGGCTCGAGCAGACAGCCGC pLX_317 46.5% 71.9% 58.9% V5 (many diffs) n/a
7 ccsbBroadEn_06199 pDONR223 100% 71.7% 58.3% None (many diffs) n/a
8 ccsbBroad304_06199 pLX_304 0% 71.7% 58.3% V5 (many diffs) n/a
9 TRCN0000475216 TGCCCATTGCGGCCGTTTAATATC pLX_317 25% 71.7% 58.3% V5 (many diffs) n/a
Download CSV