Transcript: Human XM_024454056.1

PREDICTED: Homo sapiens ADP-ribosyltransferase 3 (ART3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ART3 (419)
Length:
1531
CDS:
120..1259

Additional Resources:

NCBI RefSeq record:
XM_024454056.1
NBCI Gene record:
ART3 (419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036447 CCTGAAATGTACGGACAGGAT pLKO.1 239 CDS 100% 2.640 3.696 N ART3 n/a
2 TRCN0000036448 GCCCGAAAGACTCAAATCTTT pLKO.1 354 CDS 100% 0.563 0.788 N ART3 n/a
3 TRCN0000422117 ATCAGTGTTTCTGCTATAAAT pLKO_005 1221 CDS 100% 15.000 10.500 N ART3 n/a
4 TRCN0000435200 GTATTGAGAACCTAGAATATT pLKO_005 919 CDS 100% 15.000 10.500 N ART3 n/a
5 TRCN0000434866 GAATAGCCCTGATGGCATATA pLKO_005 403 CDS 100% 13.200 9.240 N ART3 n/a
6 TRCN0000036446 CCAGGGCACTTCATTTACATT pLKO.1 614 CDS 100% 5.625 3.938 N ART3 n/a
7 TRCN0000036445 GCTGGCAATAACCTTATCCTT pLKO.1 831 CDS 100% 3.000 2.100 N ART3 n/a
8 TRCN0000036444 CCATGATTCTAGTGGACATTT pLKO.1 163 CDS 100% 13.200 7.920 N ART3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454056.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05854 pDONR223 100% 97.3% 97.1% None 890_891ins30;1058C>T n/a
2 ccsbBroad304_05854 pLX_304 0% 97.3% 97.1% V5 890_891ins30;1058C>T n/a
3 TRCN0000466162 GAGGAATCTTCGTGCCCGAAATAT pLX_317 8.3% 97.3% 97.1% V5 890_891ins30;1058C>T n/a
4 TRCN0000489315 CCTGTATGGTATTGTCGGAGACCT pLX_317 31% 97.3% 97.1% V5 (not translated due to prior stop codon) 890_891ins30;1058C>T n/a
5 ccsbBroadEn_00108 pDONR223 100% 96.9% 94.6% None (many diffs) n/a
6 ccsbBroad304_00108 pLX_304 0% 96.9% 94.6% V5 (many diffs) n/a
7 TRCN0000465777 CTAAGCTAAGTTTCGTGCCGGAGG pLX_317 30.7% 96.9% 94.6% V5 (many diffs) n/a
Download CSV