Transcript: Human XM_024454136.1

PREDICTED: Homo sapiens LRP2 binding protein (LRP2BP), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRP2BP (55805)
Length:
4454
CDS:
109..1152

Additional Resources:

NCBI RefSeq record:
XM_024454136.1
NBCI Gene record:
LRP2BP (55805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412926 CAACCGCTAAACACTATTATT pLKO_005 1061 CDS 100% 15.000 21.000 N LRP2BP n/a
2 TRCN0000435206 ATCTCGTGGAGTATTACTATA pLKO_005 851 CDS 100% 13.200 18.480 N LRP2BP n/a
3 TRCN0000146788 CCGAGACCATATCAAGTATTA pLKO.1 1392 3UTR 100% 13.200 18.480 N LRP2BP n/a
4 TRCN0000422777 TATACAGCAAGTATCGTTTAT pLKO_005 1422 3UTR 100% 13.200 18.480 N LRP2BP n/a
5 TRCN0000130453 GCAGATGAACTTCACTCCTTA pLKO.1 1111 CDS 100% 4.950 6.930 N LRP2BP n/a
6 TRCN0000129890 GTATCTCAGTATGCTGCTAAA pLKO.1 157 CDS 100% 10.800 8.640 N LRP2BP n/a
7 TRCN0000436289 CAACCTCGGAAGAGCTTATTA pLKO_005 519 CDS 100% 15.000 10.500 N LRP2BP n/a
8 TRCN0000146274 CCTCACTTCAAGCACTAATTT pLKO.1 4145 3UTR 100% 15.000 10.500 N LRP2BP n/a
9 TRCN0000128299 GAAAGACCATCAAGCAACTTA pLKO.1 369 CDS 100% 5.625 3.938 N LRP2BP n/a
10 TRCN0000129927 GATGAACTTCACTCCTTACTT pLKO.1 1114 CDS 100% 5.625 3.938 N LRP2BP n/a
11 TRCN0000149614 GCCCTAAGTAAAGAGCACTTT pLKO.1 3008 3UTR 100% 4.950 3.465 N LRP2BP n/a
12 TRCN0000149734 GCATATTTCCTACGAGGTCAA pLKO.1 289 CDS 100% 4.050 2.835 N LRP2BP n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3292 3UTR 100% 4.950 2.475 Y KAAG1 n/a
14 TRCN0000178741 CACACACATACACACACACAA pLKO.1 3306 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08591 pDONR223 100% 99.9% 100% None 81T>C n/a
2 ccsbBroad304_08591 pLX_304 0% 99.9% 100% V5 81T>C n/a
3 TRCN0000477984 GTGATGTAGACTGAACAACTAATA pLX_317 33.9% 99.9% 100% V5 81T>C n/a
Download CSV